ID: 1060558671

View in Genome Browser
Species Human (GRCh38)
Location 9:124524603-124524625
Sequence TCTTTCATGCAGTTGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060558668_1060558671 3 Left 1060558668 9:124524577-124524599 CCTTTTTTGAGGGCAAGGGTGAG 0: 1
1: 0
2: 0
3: 10
4: 188
Right 1060558671 9:124524603-124524625 TCTTTCATGCAGTTGGTGATGGG 0: 1
1: 0
2: 0
3: 9
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060558671 Original CRISPR TCTTTCATGCAGTTGGTGAT GGG Intronic
902724105 1:18323785-18323807 TCTGTCATACAGTTGCTCATTGG - Intronic
902899887 1:19507600-19507622 TCTTTTGTGCCCTTGGTGATGGG - Intergenic
904275330 1:29380094-29380116 TTTTCCATGCACTTGGTGCTGGG + Intergenic
904899408 1:33844733-33844755 TCCTTCACGCAGTTGCTGTTAGG + Intronic
905401556 1:37707314-37707336 TCATTCAGGCAGTTAGTGCTAGG + Intronic
906072178 1:43025051-43025073 GGATTCATGCAGTTGGTGAGTGG + Intergenic
906121408 1:43394456-43394478 TTTTTCATGCAGCTGGTCCTTGG + Intronic
909309849 1:74132113-74132135 TCTTTGATGCAGTTGTGAATGGG - Intronic
911676425 1:100663801-100663823 TCTTTCACTCACTTGCTGATGGG + Intergenic
911729058 1:101272872-101272894 TCTTTCACCCACTTGTTGATGGG + Intergenic
911946403 1:104114847-104114869 TCCTTCACCCACTTGGTGATAGG - Intergenic
913311957 1:117507810-117507832 TCTTTCTTGCAGCTGGAGAGGGG - Intronic
914356260 1:146887188-146887210 TTGTTCAGCCAGTTGGTGATTGG - Intergenic
916605250 1:166335973-166335995 ACCTTCATGCAATAGGTGATGGG + Intergenic
918574339 1:186038207-186038229 TGTTTCATGCAGTTAGTTAAAGG - Intronic
920198965 1:204247663-204247685 TCTTTATTTCAGTTGGTGGTGGG - Intronic
920311597 1:205052023-205052045 TCTTGCAGGCAGTTGGTGAAAGG + Intronic
924315184 1:242788015-242788037 TATGTTATGCAGTTGGGGATGGG - Intergenic
1062877180 10:952485-952507 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877186 10:952537-952559 TCTTTTATGCAGTTGGTTCTGGG - Intergenic
1062877192 10:952589-952611 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877198 10:952641-952663 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877204 10:952693-952715 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877210 10:952745-952767 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877216 10:952797-952819 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877222 10:952849-952871 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877228 10:952901-952923 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877234 10:952953-952975 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877240 10:953005-953027 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877246 10:953057-953079 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877252 10:953109-953131 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877258 10:953161-953183 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877264 10:953213-953235 TCTGTTATGCAGTTGGTTGTGGG - Intergenic
1062877270 10:953265-953287 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877276 10:953317-953339 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877282 10:953369-953391 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877288 10:953421-953443 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877294 10:953473-953495 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062877311 10:953629-953651 TCTGTTATGCAGTTGGTTCTGGG - Intergenic
1062990745 10:1813330-1813352 GCTGTCATGCAGTTGTTCATGGG - Intergenic
1063273489 10:4538312-4538334 TCTTTAATCCATTTGATGATCGG + Intergenic
1064470545 10:15630992-15631014 TCCTTCATGCACTTTTTGATGGG + Intronic
1066466154 10:35652103-35652125 TCCTTGATTAAGTTGGTGATAGG + Intergenic
1066613204 10:37271824-37271846 TCCTTCATCCAGTTTTTGATGGG + Intronic
1066709288 10:38216250-38216272 TCTTAAATGCATTTGGTGAGGGG + Intergenic
1068063748 10:52102553-52102575 TCTTTCATGATTTTCGTGATTGG - Intronic
1069363016 10:67665533-67665555 TCTGTCCTGCAGTAGGTGAGTGG - Intronic
1069421427 10:68249975-68249997 GCTTTCATGTAGCTGGGGATGGG - Intergenic
1073699253 10:105907081-105907103 TCTTTCATGAAATTGGTCCTTGG + Intergenic
1075838451 10:125476455-125476477 TCTATGATGAAGTTGGTGCTAGG + Intergenic
1080960193 11:37148991-37149013 TCTTTCACCCACTTGTTGATGGG - Intergenic
1081616880 11:44596447-44596469 TCCTTCATGCAGTGGGGGTTGGG + Intronic
1082114031 11:48308475-48308497 TCATTCATGAAGTTGTTGAAAGG - Intergenic
1083454048 11:62766231-62766253 TCTTTCTTGCAGTTTGCTATTGG + Exonic
1083823824 11:65187245-65187267 ACTTTCAAGAAGTTGGTGAAGGG + Exonic
1086327569 11:85719537-85719559 TTTTTCCTGATGTTGGTGATGGG - Intronic
1087020904 11:93602277-93602299 TCTTTCACCCAGTTTTTGATGGG - Intergenic
1092631569 12:10383960-10383982 TTTTTCATCCAGTTTGTTATTGG - Intronic
1094455740 12:30630852-30630874 TCTTTCCTTCAGTTGTTGCTGGG + Exonic
1095077058 12:37943693-37943715 TCTTTGAAGCAGTTGTGGATTGG + Intergenic
1095684109 12:45012687-45012709 TTTTCCATGCCGCTGGTGATGGG - Intergenic
1098106996 12:67079059-67079081 TCTTTCCTGCACTTGGTGACTGG + Intergenic
1098515294 12:71368697-71368719 TCTTTCATACACTTTTTGATGGG - Intronic
1098845026 12:75524362-75524384 TGTTTCATGTAGTTGGTGCCTGG + Intergenic
1099047938 12:77747257-77747279 TCCTTCATCCACTTGTTGATGGG + Intergenic
1099508976 12:83509996-83510018 TCATTCCTGCAATTGGTCATGGG - Intergenic
1099820082 12:87698020-87698042 TCTTTGATGCAATTGTGGATGGG + Intergenic
1101364394 12:104058277-104058299 ATTTTCATGCAGTTGGTGCCTGG + Intronic
1101732130 12:107435543-107435565 TGTCTCATGCAGTTGGTGCAGGG + Intronic
1103965178 12:124634236-124634258 TCTTTCCTGCAGTTCATGAGGGG + Intergenic
1105045060 12:132995990-132996012 TCTGTCATGCAGTAGGGGAATGG + Intronic
1105442593 13:20427804-20427826 TCCTTCCTGAAATTGGTGATTGG - Intronic
1106652770 13:31709547-31709569 TCTGTTATTTAGTTGGTGATGGG + Intergenic
1108401172 13:50045937-50045959 TCTTTCATGCAATGGTTGAAAGG + Intergenic
1108559699 13:51630609-51630631 TCTTTCACCCAGTTGATGAGGGG + Intronic
1109936242 13:69288717-69288739 TCTTTTAAGCACTTGGGGATCGG - Intergenic
1111708481 13:91781640-91781662 TATTTCATGCGGTTGGTAAAAGG - Intronic
1115246933 14:31305167-31305189 TCTTTCTTTTAGTTGATGATGGG - Exonic
1116358853 14:43967196-43967218 TTGTTGATGCAGTTGGTTATAGG - Intergenic
1117582417 14:57165471-57165493 TCTTTCACACAGTTGGTGGAAGG + Intergenic
1117890989 14:60422002-60422024 TCCTTCATCCACTTGTTGATGGG + Intronic
1117942597 14:60984104-60984126 TCTTTCACACTGTTGGTGAGAGG + Intronic
1119124406 14:72112279-72112301 TCTTTCATGCAGTTCGTTGGTGG + Intronic
1128533616 15:68472639-68472661 TATTTCTTGCTGTTGGTGGTAGG - Intergenic
1134001050 16:10783062-10783084 TCTTTCTTGGAGTGGGTGAGGGG + Intronic
1135640861 16:24118819-24118841 TCTTTGATGCAGTGTGTGCTAGG + Intronic
1138639252 16:58369955-58369977 TCTTTCATGGCATTGGAGATGGG + Intronic
1138866715 16:60830433-60830455 TCTTTCACCCACTTGTTGATGGG - Intergenic
1139977756 16:70828275-70828297 TTGTTCAGCCAGTTGGTGATTGG + Exonic
1141143362 16:81512304-81512326 TCTTTCTTGCTGTGGTTGATGGG + Intronic
1141368972 16:83469787-83469809 TCTTTCCTGCGGTGGGGGATGGG + Intronic
1142372902 16:89692802-89692824 TCTTACATGCTGTTGATGTTTGG - Intronic
1144135637 17:12292200-12292222 GCTTTCATGAGGTTGGTGCTGGG + Intergenic
1144642066 17:16943104-16943126 TCTGTCATGCAGATGGTGCTGGG - Intronic
1146313066 17:31785703-31785725 TCCTTCACCCACTTGGTGATGGG - Intergenic
1147035860 17:37680091-37680113 TCCTTCATCCACTTGTTGATAGG - Intergenic
1147527996 17:41245177-41245199 TCCTTCATCCAGTTTTTGATGGG - Intronic
1148943645 17:51238679-51238701 TGTTTCCTGCAGTTACTGATTGG - Intronic
1152481353 17:80555766-80555788 GACTTCATGTAGTTGGTGATGGG + Intronic
1153203713 18:2673099-2673121 TTTTTGATGCTGGTGGTGATTGG + Intronic
1153430567 18:5011934-5011956 TCATTCATGCATCTGTTGATGGG - Intergenic
1154393316 18:13963088-13963110 TCTTTCATCCACTTTTTGATGGG + Intergenic
1158580341 18:58675355-58675377 GCTTTCATGCAGTTTATTATAGG + Intronic
1162664440 19:12197746-12197768 TCTTTCGTGCATTTTTTGATTGG + Intergenic
1162872776 19:13598818-13598840 TCTGTCATGTAGTTGCTGCTGGG - Intronic
1165247830 19:34507735-34507757 TTTTTCATGGTGGTGGTGATGGG + Exonic
1165363226 19:35349598-35349620 TCTTTGAGGGAGTTAGTGATAGG + Intergenic
1166818119 19:45559182-45559204 TCTCTCATGAAGTTGGAGTTAGG - Intronic
927730961 2:25471363-25471385 TTTTTCATGCACTTCGTGTTGGG - Intronic
928653066 2:33422262-33422284 TCTTAGATGCAGTGGGTGGTTGG - Intergenic
930424753 2:51198406-51198428 TCTTTCATTCATAGGGTGATGGG + Intergenic
932383916 2:71313171-71313193 TCTTTCATGATTTTGTTGATTGG + Intronic
932463833 2:71900451-71900473 TTCTTCATGCAGTTGTTGAGAGG + Intergenic
932841054 2:75082746-75082768 TCCTTCATGCACTTTTTGATGGG + Intronic
934736251 2:96691339-96691361 TCCTTCCTGCAGCTGGTGAGGGG + Intergenic
938007429 2:127799133-127799155 TATTTAATGCAGTTGGCAATTGG - Intronic
940188920 2:151017947-151017969 TCTTTCATAAAGTTGATGTTGGG + Intronic
941105863 2:161352071-161352093 AATTTGATGCATTTGGTGATTGG + Intronic
941409274 2:165132951-165132973 TCTTTCACCCACTTGTTGATGGG - Intronic
943618180 2:190117606-190117628 TCTTCTAAGCAGTGGGTGATGGG - Intronic
943999544 2:194815147-194815169 TCTTTTAGGGAGTTGGGGATGGG - Intergenic
945473779 2:210257730-210257752 TCTTTCACCCACTTGTTGATGGG - Intergenic
947546220 2:231012111-231012133 TCCTTCTTGCCGCTGGTGATTGG - Intronic
1169773161 20:9223482-9223504 TCTTTCATGCAGTTGCAGTCAGG + Intronic
1170118505 20:12887107-12887129 TCACTCATGCAGTTGTTGACAGG + Intergenic
1170326907 20:15166069-15166091 TCTTGCATGCAGCTGGGGGTAGG + Intronic
1170598153 20:17820967-17820989 TCTTTCCTGCAGTTTATGCTTGG - Intergenic
1172564059 20:35914567-35914589 TCTTTCATTCAGTAGGTTTTCGG - Intronic
1174433786 20:50490801-50490823 TCTCTCATGCAGTTGGCTACTGG + Intergenic
1174729897 20:52905565-52905587 CCTTTCATTCACTTGGTGACAGG + Intergenic
1175072774 20:56348336-56348358 TCTTACATTCACTTGGTAATTGG - Intergenic
1181118860 22:20651899-20651921 TGTTTCATGCAAAGGGTGATAGG + Intergenic
1182021708 22:27087009-27087031 GCTCTCAGGCAGTGGGTGATGGG + Intergenic
1183307413 22:37089954-37089976 TCATTCATGCATTTGTTCATTGG + Intronic
1185136071 22:49073372-49073394 TCATTCATTCAGTTGGTCAGAGG - Intergenic
949606133 3:5656334-5656356 TGTGTCATGTAGCTGGTGATAGG - Intergenic
950685026 3:14610721-14610743 ACTGTCATTCAGTTGGTGAATGG - Intergenic
951821496 3:26818632-26818654 TATTTCATGTACTTGGTGGTTGG - Intergenic
953378800 3:42450958-42450980 TCATGCATGGAGTTGGTGCTGGG + Intergenic
954492451 3:50919505-50919527 TCTTTCAAGCAGTTGTGAATGGG + Intronic
954772276 3:52982370-52982392 TCTTTCATGATTTTTGTGATTGG - Intronic
956513147 3:70016407-70016429 TCTTTCACTCACTTTGTGATGGG + Intergenic
957721808 3:84011987-84012009 TCTTTCAAGCAGTTGTGAATGGG - Intergenic
959837722 3:110940175-110940197 TGTTTCATGAAGGTGGTGTTAGG - Intergenic
960589429 3:119351144-119351166 TCTTCCAGGCAGTAGGTGCTGGG - Intronic
962467647 3:135675093-135675115 ACTCTCATCCAGTTGGTGACAGG - Intergenic
963819310 3:149870272-149870294 TTTTCCTTGCAGTTGGTGCTCGG + Intronic
964360500 3:155891003-155891025 TCTTTCATTCTATTGGTGATTGG - Intronic
964846328 3:161048249-161048271 TCTTTCACCCACTTTGTGATGGG - Intronic
966649665 3:182285484-182285506 TTTTTTTTGCAGTTGGTTATAGG - Intergenic
969147720 4:5138861-5138883 TCTGGCATTCAGTAGGTGATGGG + Intronic
971757963 4:30724449-30724471 TTTTTCCTGCAGTTGGTGACTGG - Exonic
973049318 4:45575361-45575383 TCTTTCATCCACTTTTTGATGGG - Intergenic
973065320 4:45782876-45782898 TCCTTCATCCACTTGTTGATGGG - Intergenic
974126898 4:57707652-57707674 TTCTTCATTCAGTAGGTGATGGG - Intergenic
974307756 4:60162694-60162716 TCTTCCATGCACTTGGTCAAAGG - Intergenic
974637756 4:64587746-64587768 TCTTTCATGCTTTTTGTGGTAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
975887884 4:78986890-78986912 AGTTTCATGCAGTTGATGGTTGG + Intergenic
976859586 4:89647201-89647223 TCCTTCACGCAGTTTTTGATGGG + Intergenic
978256879 4:106702935-106702957 TCTTTCACCCACTTTGTGATGGG - Intergenic
979287365 4:118941306-118941328 TCCTGAATGCAGTTGGTGACTGG - Intronic
981243351 4:142505463-142505485 TCTTACCTCCAGTTGGTGACAGG - Intronic
981726877 4:147857237-147857259 TGTTTCATTCGGTTGGTGAGGGG + Intronic
983582459 4:169323002-169323024 TCCTTCATCCACTTGTTGATGGG - Intergenic
983643183 4:169962875-169962897 AATTTCAGGCAGATGGTGATGGG - Intergenic
984422177 4:179537793-179537815 TCTTTCATGCAATCAGAGATTGG - Intergenic
985082341 4:186279015-186279037 TCTTTAATACAGTATGTGATAGG + Intronic
994849187 5:105032361-105032383 TTTTACATGGACTTGGTGATTGG - Intergenic
995227735 5:109721940-109721962 TCTGTCATGAAGTTGCTGAAAGG - Intronic
995728262 5:115205302-115205324 TCATTAAAGCAGTTGGTGATTGG - Intergenic
996084589 5:119291639-119291661 TCTTTCATGCATATGTTTATGGG + Intronic
997340386 5:133140366-133140388 TCTTTCTTGGAGTTGTTGGTGGG + Intergenic
1009997791 6:70916151-70916173 TCTTTGAGGCAGTTGGGAATGGG + Intronic
1010105145 6:72159219-72159241 TCTTTCACCCACTTGTTGATGGG + Intronic
1010311037 6:74386139-74386161 TCTTTCACCCACTTTGTGATGGG - Intergenic
1010607385 6:77907970-77907992 TCCTTCACGCACTTGTTGATGGG + Intronic
1013882734 6:114924949-114924971 TCTTTGAAGCAATTGTTGATGGG + Intergenic
1015794736 6:136999742-136999764 TCTTTCTGGCAGTTAGTAATGGG + Intergenic
1017353284 6:153470801-153470823 TCTTGCTTGCAGTTTCTGATGGG + Intergenic
1018849643 6:167577835-167577857 CCTTTCGTGCAGTTGGTGTTGGG + Intergenic
1020052226 7:5089247-5089269 TCTTGCATGCAGTTGGTGGAAGG - Intergenic
1020325437 7:6970802-6970824 TCCTTCATCCAGTTTTTGATGGG + Intergenic
1021700570 7:23315439-23315461 AGTTGCATGCAGTAGGTGATAGG - Intronic
1021716050 7:23463379-23463401 TCTTTCATGCAGTTAGCAAGGGG - Intronic
1023267698 7:38425217-38425239 TCTTCCATCCTGTTGGTCATGGG - Intronic
1024149348 7:46554223-46554245 TCTTTTCAGCAGATGGTGATGGG - Intergenic
1025629929 7:63262118-63262140 TCCTTCACCCAGTTGTTGATGGG + Intergenic
1028055248 7:86232826-86232848 TCCTTCACGCACTTGTTGATGGG - Intergenic
1028235600 7:88357698-88357720 TATCTCATGCAGTTGTTGAGAGG + Intergenic
1030418427 7:109274976-109274998 TTTTTAATGCTGTTGGTAATAGG + Intergenic
1031221692 7:118974738-118974760 TCTTTCATTGAGATGGAGATTGG + Intergenic
1032615841 7:133469703-133469725 TCTCACATCCAGTTGCTGATAGG - Intronic
1033153981 7:138940836-138940858 TCTTTCACCCACTTGTTGATGGG + Intronic
1034208533 7:149341162-149341184 TCTTTGAAGCAGTTGGGAATGGG + Intergenic
1034217061 7:149415846-149415868 TCTTTCATTCAGTTCGTGCGTGG - Intergenic
1034840661 7:154392449-154392471 TATTTCATGCAGGTGGAGAGTGG + Intronic
1035216441 7:157371167-157371189 TCTTCCACACAGTGGGTGATGGG - Intronic
1036051577 8:5205306-5205328 TCTTTCTTCCAGTTGTTCATAGG - Intergenic
1041904197 8:63013491-63013513 TCTTTCCTGCTGGTGGTGGTGGG + Intergenic
1042284359 8:67091586-67091608 CCTTTCAGGGAGTTGTTGATTGG + Intronic
1042732559 8:71953598-71953620 TCTTCCAGTCTGTTGGTGATGGG - Intronic
1043898673 8:85759448-85759470 TCCTTCCTGCACTTGTTGATGGG + Intergenic
1043902248 8:85786917-85786939 TCCTTCCTGCACTTGTTGATGGG + Intergenic
1043907078 8:85823491-85823513 TCCTTCCTGCACTTGTTGATGGG + Intergenic
1044142293 8:88670927-88670949 TGCCTCATGCAGTTGTTGATAGG - Intergenic
1044234966 8:89820187-89820209 TCCTTCATACACTTGTTGATGGG + Intergenic
1044890579 8:96831206-96831228 TCATTCATTCAGTGGGTTATGGG + Intronic
1046710017 8:117500013-117500035 TCTCTCATGCAGTTGTAGACAGG + Intergenic
1046813913 8:118563190-118563212 TATTTCATAAATTTGGTGATGGG + Intronic
1047772018 8:128037245-128037267 CCTGTCTTTCAGTTGGTGATGGG + Intergenic
1048077995 8:131094249-131094271 ACTTTCATGCAGTTGCTACTTGG + Intergenic
1050392069 9:5154644-5154666 TCCTTCGTCCAGTTGTTGATGGG - Intronic
1050827121 9:9960980-9961002 TCTTTCACCCACTTGTTGATGGG - Intronic
1050841780 9:10158705-10158727 TTTTCCATGCAGTTGGTGGCAGG - Intronic
1052788516 9:32852359-32852381 TTTTTCATGCATTAGGTCATGGG + Intergenic
1053037654 9:34838991-34839013 TGTTTCAGGCAATGGGTGATTGG + Intergenic
1053460259 9:38263332-38263354 TTTTTCATGCTCTTGGTGCTGGG - Intergenic
1053558965 9:39169688-39169710 TCTTACATTCACCTGGTGATTGG - Intronic
1053823087 9:41989935-41989957 TCTTACATTCACCTGGTGATTGG - Intronic
1054138146 9:61449255-61449277 TCTTACATTCACCTGGTGATTGG + Intergenic
1054607486 9:67197431-67197453 TCTTACATTCACCTGGTGATTGG + Intergenic
1055914991 9:81391782-81391804 TCCTTGCTGCAGTTGGTGCTGGG - Intergenic
1056368431 9:85929595-85929617 TCTTTCATACACATGGTTATGGG + Intergenic
1057018389 9:91676070-91676092 TCTTTCAGGCAGCTGGGGGTGGG + Intronic
1058791199 9:108447497-108447519 TCCTTCACCCATTTGGTGATGGG - Intergenic
1060558671 9:124524603-124524625 TCTTTCATGCAGTTGGTGATGGG + Intronic
1060571585 9:124645462-124645484 ACTTTCTTTCAGTTGGTGTTAGG - Intronic
1060988995 9:127837672-127837694 TCTTATAAGCATTTGGTGATTGG - Intronic
1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG + Intergenic
1188902773 X:35754390-35754412 TTTTGCATGCAGTTGATGTTAGG + Intergenic
1191935140 X:66419439-66419461 TCCTTCATCCACTTGTTGATGGG - Intergenic
1191966271 X:66761872-66761894 TCTTTCATCCACTTTTTGATGGG + Intergenic
1194405552 X:93492328-93492350 TCACTCAGGCAGGTGGTGATGGG - Intergenic
1194613618 X:96074573-96074595 TTTTCCATGCACTTGGTGTTGGG - Intergenic
1198646311 X:138810764-138810786 TCCTTCATCCACTTGTTGATGGG - Intronic