ID: 1060559298

View in Genome Browser
Species Human (GRCh38)
Location 9:124529709-124529731
Sequence CCTGACATCCTCCCAAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060559298_1060559302 19 Left 1060559298 9:124529709-124529731 CCCAACCTTGGGAGGATGTCAGG 0: 1
1: 0
2: 0
3: 15
4: 113
Right 1060559302 9:124529751-124529773 CTGCCACTGCAAGTGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060559298 Original CRISPR CCTGACATCCTCCCAAGGTT GGG (reversed) Intronic
901737056 1:11319401-11319423 GCTGACATCCACCCAACTTTGGG + Intergenic
903212994 1:21829074-21829096 CCTGGCATCCTCCCCAGGGCTGG - Exonic
904840828 1:33370817-33370839 CCTGTCATCCTCCCAGTGTCAGG - Intronic
905851471 1:41277998-41278020 ACAGACATCCTCCCAATGCTGGG - Intergenic
907333272 1:53685012-53685034 CCTGACTTCCACCCCAGGTCAGG - Intronic
907641946 1:56199504-56199526 CCTGACACCCTACCTAAGTTAGG + Intergenic
914345745 1:146797102-146797124 GCTGAAGTCCTGCCAAGGTTAGG - Intergenic
914677645 1:149916837-149916859 CCCCACATCCTACCAAGGTTAGG + Intronic
922507542 1:226135309-226135331 CCTGACATTGTCCCTAGGTGCGG - Intergenic
922880500 1:228976839-228976861 CCTGACATCCTGAGATGGTTAGG + Intergenic
1063390876 10:5649233-5649255 CATGAACTCCTCCCTAGGTTGGG - Intronic
1063451969 10:6156014-6156036 GCTGCCATCCTCCCAACTTTTGG + Intronic
1070599717 10:77857209-77857231 CCTTGCATCCTCCCCTGGTTTGG + Intronic
1070648042 10:78215066-78215088 CCTGACTTCCTCCCCAGGCCTGG + Intergenic
1073002891 10:100298493-100298515 CCTGACACCATCCCAAGGTCTGG - Intronic
1075555356 10:123427008-123427030 CCTCACACCTTCCCAAGGTGAGG - Intergenic
1077284602 11:1760054-1760076 AGTGACTTCCTCCCCAGGTTGGG + Intronic
1078160544 11:8836320-8836342 CCTGAGAGCCTCCCAGGGTTGGG + Intronic
1083829990 11:65225486-65225508 CCTCACAGCCTCCCAGAGTTGGG - Intergenic
1086588968 11:88489005-88489027 CCTGAAATTCTCCAAAAGTTAGG - Intergenic
1097611050 12:61820968-61820990 ACAGACATCCTCTCAAAGTTTGG - Intronic
1101579900 12:106033147-106033169 CCTCACATCCTACCCAGGTTGGG + Intergenic
1103411727 12:120717022-120717044 ACTGACATCCTCCGAAAGCTGGG - Exonic
1107976155 13:45690605-45690627 TCTGACATTCTCCCAATATTAGG - Intergenic
1114624384 14:24119316-24119338 CCAGACCTTCTCCCAAGGTCAGG + Intronic
1115148132 14:30250724-30250746 CTTGACATCATCACAATGTTGGG - Intergenic
1119640805 14:76313507-76313529 CCTGACCTCCTCCCAAATTGGGG + Intronic
1119748110 14:77058869-77058891 CCTGACAGCTTCCCGAGGATAGG - Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121820524 14:96962181-96962203 CCTAACACCCTCCCAGGGCTGGG + Intergenic
1122268213 14:100556578-100556600 CCTGACATCCCCCCTGGGTCAGG + Intronic
1122794049 14:104196910-104196932 CCTGGTCTCCTTCCAAGGTTGGG + Intergenic
1127521977 15:59752068-59752090 TCTGAAATCCTCATAAGGTTGGG + Intergenic
1129386143 15:75197085-75197107 CCTGAAATCCTCCCACACTTTGG - Intronic
1130139113 15:81208686-81208708 ACTACCTTCCTCCCAAGGTTTGG - Intronic
1130141338 15:81228675-81228697 ACTACCTTCCTCCCAAGGTTTGG - Intronic
1131145606 15:90009616-90009638 CCTGGCTTCCTCCCTAGGTCTGG + Intronic
1132040624 15:98522159-98522181 GTTGACATCCTCCCAAAGTTAGG - Intergenic
1132655503 16:1040349-1040371 CCTGAGGGCCCCCCAAGGTTCGG + Intergenic
1133187869 16:4113615-4113637 CCTGAGATCCCCCCATGGTAAGG + Intronic
1133740336 16:8646579-8646601 CCTCATTTCCTCCCAGGGTTGGG + Exonic
1134189939 16:12113234-12113256 CCTGACAACCTCCCAAATTATGG - Intronic
1134680524 16:16121910-16121932 CCTGCCATCCTCCCAGGGCAGGG - Intronic
1136245631 16:28974402-28974424 CCTGTCTTCCTCCCAGGGTCTGG - Intronic
1137751434 16:50863749-50863771 ACAGACATACACCCAAGGTTAGG - Intergenic
1138560832 16:57800191-57800213 CCTGGCATTCTTCCAGGGTTGGG - Intronic
1139383978 16:66552309-66552331 CGGGAAATCCTCCCAGGGTTGGG - Intronic
1139988241 16:70918165-70918187 GCTGAAGTCCTGCCAAGGTTAGG + Intronic
1143111726 17:4556593-4556615 CCTGACCTCCCCCAAGGGTTAGG - Intergenic
1144049918 17:11489776-11489798 ACTGACATCATCCCCAAGTTGGG - Intronic
1144074388 17:11703849-11703871 ATTGTCATCCTCCCAAGCTTGGG + Intronic
1144836854 17:18161091-18161113 CCAGACATCTTCCCCAGGTAGGG - Intronic
1148292816 17:46471051-46471073 GCTGCCATCATACCAAGGTTTGG - Intergenic
1148315001 17:46688748-46688770 GCTGCCATCATACCAAGGTTTGG - Intronic
1148641911 17:49194030-49194052 CATGGCATCCTCCCAAGGGGCGG - Intergenic
1149068102 17:52504378-52504400 CCTGACATTTTCTCAAGATTAGG - Intergenic
1150496322 17:65610576-65610598 CCTGACATCCTGATATGGTTTGG - Intronic
1156223336 18:35076560-35076582 CCTGACAGACTCCCCAGGCTAGG + Intronic
1156817179 18:41325451-41325473 ACTGAAATCCTCCCAAAGTTAGG + Intergenic
1162433695 19:10644212-10644234 CCTGACATCATCCCTTGGGTGGG - Exonic
1165431963 19:35777955-35777977 CCTGATATCGTTGCAAGGTTGGG - Intronic
928125361 2:28611836-28611858 CCTGACATCCTTTCAAGGAGAGG - Intronic
928201856 2:29252225-29252247 TCTGACAACTCCCCAAGGTTTGG - Intronic
928833352 2:35515527-35515549 CCCGGCATCCTCTCAAGGTTAGG + Intergenic
928905992 2:36368224-36368246 CCTTTCATCCTCCCAACGTGAGG - Intronic
929814397 2:45219744-45219766 CCTGACGCCCTGCTAAGGTTAGG - Intergenic
930411020 2:51027306-51027328 CTTGACATCCTCCTAAGGATTGG - Intronic
932453113 2:71828326-71828348 CATGACAGCTTCCCAAGGTCTGG + Intergenic
932489915 2:72114094-72114116 CCAGCCATCCTCCCAGGGGTTGG - Intergenic
934949816 2:98568554-98568576 CCCTATAACCTCCCAAGGTTTGG + Exonic
938757473 2:134393968-134393990 CCTGCCAGCCTCTCAAAGTTAGG - Intronic
941733778 2:168949348-168949370 CCTCCCATCCTCCCAACTTTTGG + Intronic
944972710 2:205012091-205012113 CCTGACATCCTACAGAGGTAGGG - Intronic
946027484 2:216680536-216680558 CCTGCCATCCTGCCCAGGTTAGG - Intronic
946644721 2:221820659-221820681 CCTGACACCCTCCCAAGCCCAGG + Intergenic
948080168 2:235199177-235199199 CCTGACATCCACGAAAGGATGGG + Intergenic
948318521 2:237049758-237049780 CATGAAAACCTCCCAAGTTTGGG - Intergenic
1168875723 20:1171031-1171053 CCTCACATCCTCTCTAGGTGAGG + Intronic
1175315414 20:58043719-58043741 CCTGACATCCTCTCATGGGTTGG - Intergenic
1176292776 21:5055095-5055117 CAGGTCAGCCTCCCAAGGTTGGG + Intergenic
1177537117 21:22442441-22442463 AAGGACATCCTCCCAATGTTTGG - Intergenic
1177550168 21:22610781-22610803 GATGACATGTTCCCAAGGTTGGG + Intergenic
1179562071 21:42221784-42221806 CCTGACTTCCTCCTAATGCTAGG + Intronic
1179864484 21:44208555-44208577 CAGGTCAGCCTCCCAAGGTTGGG - Intergenic
1179900535 21:44391155-44391177 GCTTTCATCCTCCCCAGGTTGGG + Intronic
1181050067 22:20234245-20234267 CCCGACATCCTGTCATGGTTGGG - Intergenic
1181696825 22:24597229-24597251 CCTGTCAGCCTCCCAGTGTTGGG + Intronic
1181802325 22:25355761-25355783 CCTGACCTGCTCCCATGGGTAGG + Intronic
1182151913 22:28033730-28033752 CCTGACTTCCTCCCAGGATTTGG - Intronic
950788792 3:15456124-15456146 CTTGACTTCCTCCCAGGGGTGGG + Intronic
950880153 3:16316879-16316901 CCTGGCATCCTCTCCAGGATTGG + Exonic
954287903 3:49631771-49631793 CCTGATGCACTCCCAAGGTTTGG + Intronic
954934847 3:54317287-54317309 CCAGTCAACCTCCCAAGGTAGGG + Intronic
955023745 3:55146969-55146991 CATGTCATCCTCACAAGGTGAGG - Intergenic
956290678 3:67656308-67656330 CCTGACATGTGCCCAAGGTGTGG + Intergenic
958786965 3:98606886-98606908 CCTGGCAAACTCCTAAGGTTAGG - Intergenic
961824599 3:129592487-129592509 CCTGACATCCAGCCAGGGTGGGG + Intronic
975521559 4:75307204-75307226 CCTGACATCCACACACTGTTGGG + Intergenic
978866684 4:113521198-113521220 CCCAACATCCCCCAAAGGTTAGG + Intronic
984773065 4:183455143-183455165 CCTGATTTTCCCCCAAGGTTTGG - Intergenic
988501281 5:31785820-31785842 CCAGACCTCGCCCCAAGGTTCGG + Intronic
990294309 5:54384740-54384762 CCTGACTTCCTGCCAAGCCTAGG + Intergenic
992829824 5:80583340-80583362 CCAGAAAGCCTCCCAAGGTAAGG - Intergenic
995371500 5:111424151-111424173 CCTGAATTCCTACCATGGTTAGG - Intronic
996381308 5:122864937-122864959 ACTAAGTTCCTCCCAAGGTTAGG + Intronic
1002590344 5:180286974-180286996 CCTGAGATCCACCCAAGTTGTGG - Intronic
1004556920 6:16707248-16707270 CATGACTTCTTACCAAGGTTTGG - Intronic
1008467591 6:51847876-51847898 CCTGACATCCTCCTAAGATGTGG - Exonic
1019331337 7:462264-462286 CAGGACACCCTCCCTAGGTTTGG + Intergenic
1019637140 7:2081908-2081930 CCTGACATGGCCCCAAGGTCAGG + Intronic
1022454770 7:30548771-30548793 CCTCACATCCTCTTAAGGCTTGG - Intronic
1023020221 7:36005239-36005261 CCTTACATCCTCCCTATGATAGG - Intergenic
1023285953 7:38620015-38620037 TGGGAGATCCTCCCAAGGTTTGG + Intronic
1023286002 7:38620490-38620512 TGGGAGATCCTCCCAAGGTTTGG + Intronic
1027933229 7:84567478-84567500 CCTGAGTTCCTTCCAAGGATAGG - Intergenic
1030689160 7:112515123-112515145 TCTGACCTCCTCCCAGAGTTTGG + Intergenic
1038692074 8:29773072-29773094 CCTGAAATCCTCCCAAAGTCTGG - Intergenic
1039788964 8:40858941-40858963 CCTGTCATCCTCTCAACATTAGG + Intronic
1040707356 8:50145106-50145128 CCTGGCATCCTCCCTATGGTTGG - Intronic
1047010548 8:120668169-120668191 CCTGACAGACTCCCTGGGTTGGG - Intronic
1050483688 9:6112265-6112287 CCTGACTTCCTCGCAAGCTCTGG + Intergenic
1060274573 9:122172642-122172664 CATGACCTCCTCCCAGGGCTTGG + Intronic
1060559298 9:124529709-124529731 CCTGACATCCTCCCAAGGTTGGG - Intronic
1061169458 9:128943841-128943863 TCTGATGTCCTCCCAAGCTTGGG + Intronic
1062070231 9:134551433-134551455 CCTGGCATCCTCCGCAGGTGAGG + Intergenic
1185954189 X:4471106-4471128 CCTGATATTCTCTCAAGTTTGGG + Intergenic
1198224586 X:134633356-134633378 CCTGACCTCCTGCAAAGGTCAGG + Intronic
1200047253 X:153409461-153409483 CCTGTCATCCTCTCTAGGTTGGG + Intergenic
1200089432 X:153627494-153627516 CCTGTCATCCTCTCTAGGTTGGG - Intergenic