ID: 1060559699

View in Genome Browser
Species Human (GRCh38)
Location 9:124532937-124532959
Sequence GAAACTTTTCCTTCCTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060559699_1060559702 12 Left 1060559699 9:124532937-124532959 CCTACCAAGGAAGGAAAAGTTTC 0: 1
1: 0
2: 2
3: 13
4: 223
Right 1060559702 9:124532972-124532994 GCTGTTACTGACTTCTGCCTTGG No data
1060559699_1060559707 28 Left 1060559699 9:124532937-124532959 CCTACCAAGGAAGGAAAAGTTTC 0: 1
1: 0
2: 2
3: 13
4: 223
Right 1060559707 9:124532988-124533010 GCCTTGGTCTTGGGGCTTAAGGG No data
1060559699_1060559703 18 Left 1060559699 9:124532937-124532959 CCTACCAAGGAAGGAAAAGTTTC 0: 1
1: 0
2: 2
3: 13
4: 223
Right 1060559703 9:124532978-124533000 ACTGACTTCTGCCTTGGTCTTGG No data
1060559699_1060559705 20 Left 1060559699 9:124532937-124532959 CCTACCAAGGAAGGAAAAGTTTC 0: 1
1: 0
2: 2
3: 13
4: 223
Right 1060559705 9:124532980-124533002 TGACTTCTGCCTTGGTCTTGGGG No data
1060559699_1060559704 19 Left 1060559699 9:124532937-124532959 CCTACCAAGGAAGGAAAAGTTTC 0: 1
1: 0
2: 2
3: 13
4: 223
Right 1060559704 9:124532979-124533001 CTGACTTCTGCCTTGGTCTTGGG No data
1060559699_1060559706 27 Left 1060559699 9:124532937-124532959 CCTACCAAGGAAGGAAAAGTTTC 0: 1
1: 0
2: 2
3: 13
4: 223
Right 1060559706 9:124532987-124533009 TGCCTTGGTCTTGGGGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060559699 Original CRISPR GAAACTTTTCCTTCCTTGGT AGG (reversed) Intronic
901146268 1:7066815-7066837 GAAAGTTTTACTTCCTTTCTGGG + Intronic
902337396 1:15761267-15761289 CACGCTTTTCCTTCCTTGGGTGG - Intronic
904213113 1:28898651-28898673 TAATCTTTTCCTTCCTTTCTTGG - Intronic
905040211 1:34949825-34949847 GAATATTTTCGATCCTTGGTTGG - Intergenic
906013386 1:42550873-42550895 GAATCTTTTTCTTCCTCTGTGGG + Intronic
906748924 1:48241600-48241622 GAAACTTTTACTTCCTTGGATGG - Intronic
910960098 1:92752598-92752620 GGAACTTTTCCTTCTTTGTGGGG + Intronic
911778637 1:101846882-101846904 CAAACTCTCCCATCCTTGGTGGG - Intronic
916916268 1:169409496-169409518 GAATGTTTGCCTGCCTTGGTAGG - Intronic
918788817 1:188799455-188799477 GATTCTTTGCCTTCCTTAGTGGG - Intergenic
920575842 1:207059744-207059766 GAAACTTTTCCTTCCGAGGGTGG + Intronic
921401908 1:214734056-214734078 GCACCTTTTGCTTCCTTGGATGG - Intergenic
921548352 1:216501285-216501307 GAAAATTTTCATTTCTTGGAAGG - Intergenic
921765329 1:218965722-218965744 GAAACCTTTCCTATCTTTGTGGG + Intergenic
921989512 1:221349334-221349356 TAAAATTTTCCTCCCTTTGTTGG - Intergenic
923674488 1:236067903-236067925 GAAACCTTTCCTTCCATAGATGG - Intergenic
924682692 1:246253662-246253684 AAATGTTTTACTTCCTTGGTTGG + Intronic
1062862803 10:823301-823323 GACAGTTGTCCTCCCTTGGTGGG + Intronic
1063666725 10:8065551-8065573 GAAAGTTTTCCTTCTTTGGCTGG - Intronic
1063731031 10:8697386-8697408 GAAACTTTTCCTTCATTTCCAGG + Intergenic
1064024695 10:11838090-11838112 GAAACCTTTCCTTTCTGTGTTGG + Intronic
1064162184 10:12956214-12956236 GAAACTTTTCATTTCTTCTTGGG - Intronic
1064511290 10:16095511-16095533 AAAACTTTTCCTTCTAAGGTCGG + Intergenic
1064601198 10:16995113-16995135 GTCACTGTTCCTTTCTTGGTTGG - Intronic
1064773711 10:18752245-18752267 GAAACTTTGCAGTCCTTAGTAGG + Intergenic
1066069772 10:31795810-31795832 AAATATTTTCCATCCTTGGTTGG + Intergenic
1066303143 10:34114663-34114685 TTAGCTTTCCCTTCCTTGGTTGG + Intronic
1067110988 10:43399813-43399835 GACACAGTTCCTGCCTTGGTGGG + Intronic
1069393768 10:67965734-67965756 GTAACTTTTCATTGCTTGCTAGG - Intronic
1069699278 10:70409376-70409398 GTAACTTTACCTTCCTTTGAGGG - Intronic
1071981400 10:91007706-91007728 GAATCTGTTCCTTCCTTGTGGGG + Intergenic
1079363087 11:19785986-19786008 GAACCTTTTCCCTCCTTGCCTGG - Intronic
1081440177 11:43072197-43072219 GAAACATTTCCTTTCTCAGTAGG - Intergenic
1081925925 11:46828235-46828257 GTATCTTTTCCTTACTTGGGTGG + Intronic
1082079042 11:47997602-47997624 GATACTTTTCCTGTCTGGGTGGG + Intronic
1082985759 11:59169722-59169744 TAAACTTTCCATTCCTTGATAGG - Intergenic
1083090708 11:60197239-60197261 GAAACTTTCCATACCATGGTAGG + Intergenic
1085042628 11:73335463-73335485 GAAACTTTTCCTTCCCAGCCTGG + Intronic
1085237865 11:75029186-75029208 GAAACTGTGCCTTCCTTTCTAGG + Intergenic
1086189293 11:84059483-84059505 GACTCTTTTCCTTCCTTGCAGGG - Exonic
1086272400 11:85083147-85083169 GAAAATTTGTCTTCCTTGTTGGG + Intronic
1088310951 11:108459953-108459975 AAAACTTATTCTTCCTTAGTTGG - Intronic
1088359549 11:108976423-108976445 GAAACCTTTCTTGCTTTGGTAGG - Intergenic
1088609926 11:111567070-111567092 GAATATTTTCCATCCATGGTTGG - Intergenic
1089804396 11:121070234-121070256 AACACTTTTCCATACTTGGTGGG + Intronic
1090766740 11:129882719-129882741 GAGACTTTTCTGTCTTTGGTGGG - Intronic
1095828622 12:46558364-46558386 GAAAGGTTTCCTTCCATGTTGGG + Intergenic
1095897936 12:47299617-47299639 GAAACTTTTCCTTCAGTTGAAGG - Intergenic
1096769668 12:53927093-53927115 GAATCTTTGCTTTCCTTGATGGG - Intergenic
1097218886 12:57435238-57435260 GAAACTTTTCCTTTCCTTGAGGG - Intronic
1097751560 12:63360054-63360076 GCAACATTTCAGTCCTTGGTAGG - Intergenic
1099166600 12:79314518-79314540 GAAACTTTGAGTTCCTTTGTGGG - Intronic
1099260266 12:80371563-80371585 AAAATATTTCCTTCCTTGGAAGG - Intronic
1099886010 12:88531828-88531850 GAATATTTTCCATCTTTGGTTGG - Intronic
1100195070 12:92236424-92236446 GAAACTTATCCTGCTTTGGAAGG - Intergenic
1100281928 12:93126529-93126551 GAACCTTCTCCTACCTTTGTAGG + Intergenic
1101998901 12:109544515-109544537 GAAGCTTTTCCTGGCTTTGTGGG - Intergenic
1104063053 12:125284108-125284130 GAGATTTTTCCTTCTATGGTAGG + Intronic
1104853797 12:131892597-131892619 GAAACATGTCCTTCCTCGGTGGG + Intergenic
1104916087 12:132265307-132265329 GAAGCCTTTCCTTCCGTGGTGGG + Intronic
1105567261 13:21562321-21562343 GAAACTTTTCCACTGTTGGTGGG - Intronic
1108453390 13:50588873-50588895 TAGACTTTTCTTTCCTTGTTTGG + Intronic
1112973335 13:105287359-105287381 GGGACTTTTCCTTCTTTGCTTGG - Intergenic
1113044920 13:106145622-106145644 GTAATTTTTTCTTCTTTGGTAGG - Intergenic
1116569041 14:46491679-46491701 GAAACTTTTCCTTCATAAATTGG + Intergenic
1118620178 14:67607929-67607951 GAATATTTTCCACCCTTGGTTGG - Intergenic
1120295459 14:82634479-82634501 GAGACTTTTCCTTCTTTGCTAGG + Intergenic
1120776181 14:88440166-88440188 CCAAATTTTCCTTCCTTGGCTGG + Intronic
1121247936 14:92476304-92476326 AAAAGTTTTCCTGCCTTGATTGG - Intronic
1122193518 14:100067346-100067368 GAAACTGTTTCTTGATTGGTGGG - Intronic
1122337996 14:101006450-101006472 GAGACATTTCCTTCCTTCATTGG + Intergenic
1122400866 14:101466590-101466612 GAAACCCTTCCTTCCTCGGTAGG - Intergenic
1124881101 15:33643530-33643552 GAAACTCTGCCTTCCTGAGTAGG + Intronic
1125684200 15:41553773-41553795 GAAAGTTTTTCTTCCATGTTTGG + Intergenic
1127965015 15:63916715-63916737 GAAACATTCCTTTCCTTGCTTGG + Intronic
1127965640 15:63920909-63920931 GAAACTTCTCTCTCCCTGGTTGG + Intronic
1128958522 15:71974878-71974900 CAAACTTTTCCTCCTTTGGAAGG - Intronic
1129143124 15:73620520-73620542 AAGACTTTTCCTTACTTTGTGGG - Intronic
1131588262 15:93719424-93719446 GAATATTTTCAATCCTTGGTTGG - Intergenic
1133822381 16:9248180-9248202 GAAGCTTTTCATTACTTGGGTGG - Intergenic
1133887717 16:9846175-9846197 TACACTTGCCCTTCCTTGGTGGG + Intronic
1136058956 16:27711634-27711656 GAATCTTTTCCTGCCCTGCTGGG - Intronic
1136637007 16:31530401-31530423 AAATATTTTCCATCCTTGGTTGG + Intergenic
1137898336 16:52237986-52238008 GAAACTTGCCCCTCATTGGTTGG + Intergenic
1137971812 16:52993246-52993268 GAAACATTTTCTAACTTGGTTGG - Intergenic
1139018614 16:62720529-62720551 CACACTTTGCCTTCCATGGTGGG - Intergenic
1141083629 16:81076019-81076041 GAAACTCATCTTTCCCTGGTTGG - Intronic
1142826310 17:2513535-2513557 GAAAGTTTTCCATCTTTGGTTGG + Intergenic
1143418511 17:6769878-6769900 GAAGCTTTTCTTTCTTGGGTCGG - Intronic
1143432978 17:6900417-6900439 AAAACTTTTCTTTCCTTCTTTGG - Intronic
1145737926 17:27246201-27246223 AAAAATTTTGCTTCCTTGATTGG + Intergenic
1146441984 17:32905195-32905217 GAAATCTTGCCTTCCTTGTTGGG + Intergenic
1153140674 18:1969094-1969116 GAAACTTATCCTTCTTAGTTAGG + Intergenic
1153349769 18:4066394-4066416 GAAACTTTTCCCTATTTTGTAGG - Intronic
1153615204 18:6927866-6927888 GAAACCTTTCCTTCGTGGGGAGG - Intergenic
1154010278 18:10568332-10568354 AGAACTTTTCTTTCCTTGGCTGG + Intergenic
1154373798 18:13791788-13791810 AAATATTTTCCATCCTTGGTTGG - Intergenic
1155498162 18:26462751-26462773 GAAACCTTTCCTTCCTTAAATGG + Intronic
1157787376 18:50496413-50496435 GCAACTTTTCCTTCAATGGAGGG - Intergenic
1158892691 18:61887846-61887868 GAAAGTTACACTTCCTTGGTAGG + Intronic
1166888460 19:45975268-45975290 GGAATCTTTCCTTCCTGGGTTGG + Intergenic
1167108532 19:47445614-47445636 GAAACTCTTCCTTCCTCTGATGG - Intronic
1168604480 19:57747438-57747460 TGATCTTTTCCTTCCTTTGTTGG - Intronic
929173408 2:38954281-38954303 GAAACCCTTCCTACCCTGGTGGG + Intronic
929178435 2:39005933-39005955 GTACCTTTTCCTTCCTTTTTAGG - Intronic
930305165 2:49667238-49667260 CATACTTTTCCTTACTGGGTAGG - Intergenic
933433676 2:82216947-82216969 GAAAATTTACCCTCCTTGGCCGG + Intergenic
935639748 2:105279555-105279577 TAAACTCTGCCTTCCTTGGCTGG - Intronic
936055065 2:109256404-109256426 GAAACATCTCCTTCCTTGCAGGG - Intronic
936430108 2:112455394-112455416 GAAACTTTCCCATCCTGGTTTGG + Intergenic
941052808 2:160754076-160754098 GAAATTAATCCTTCCTTTGTAGG + Intergenic
942366574 2:175234606-175234628 TAAACATTTCCTTCCTGGGTAGG - Intergenic
944442019 2:199752306-199752328 GAAACTTTTTCTTCCCTGAGTGG + Intergenic
945000936 2:205349764-205349786 GATACATTTCCTTCCTTTTTTGG - Intronic
946449777 2:219769941-219769963 GAAAGTTTTCTTTGCTTGCTAGG + Intergenic
946767971 2:223057744-223057766 CAAACTGTTCCTTCCTGTGTGGG - Intronic
947926031 2:233923442-233923464 CAAGGTTTTCCCTCCTTGGTGGG + Intronic
948289197 2:236812445-236812467 TAATATTTTCCATCCTTGGTTGG + Intergenic
1169404376 20:5311312-5311334 GTAACTTTTCCCTGCTTGGACGG + Intronic
1170500401 20:16969883-16969905 GAAACCATTCCTTCCTGGTTTGG - Intergenic
1171227356 20:23452718-23452740 GAAAGGTTTTCTTCCTTGCTTGG + Exonic
1171573572 20:26276837-26276859 GAAGCTCTCCCTCCCTTGGTGGG + Intergenic
1172003553 20:31800948-31800970 GTAACTTTTCCTTACTTTGCAGG + Exonic
1173346148 20:42201928-42201950 GCAACTTTTCTCTTCTTGGTTGG - Intronic
1174616414 20:51838881-51838903 GAACCTTTTCCTTCATAGGGTGG - Intergenic
1177185910 21:17795809-17795831 GAAACTTTTATTTCATTGGAGGG - Intronic
1177926386 21:27221085-27221107 GAAAGTTTTCCTTTTTTGGATGG + Intergenic
1178090885 21:29161881-29161903 CAAACCCTTCCTTCCTTGCTTGG + Intronic
1178577974 21:33812187-33812209 GAAACTTTTCCTTACTCTTTTGG + Intronic
1179248110 21:39650541-39650563 GAAACCATTCCTCCCTGGGTGGG + Intronic
1179295017 21:40053989-40054011 GAAACTTTTCCTATGTTGGCTGG + Intronic
1181847105 22:25719675-25719697 GCATCTTTTCTTTTCTTGGTGGG + Intronic
1183112747 22:35662967-35662989 GAAAACTTGCCTTCCTTGTTGGG - Exonic
1184019752 22:41813141-41813163 GGCACTGTTCCTTCCTTGCTTGG + Intronic
949954344 3:9255480-9255502 GAGACTTTGCCTTCCTTGCCAGG - Intronic
950255974 3:11506415-11506437 AAAACATTTCCATCATTGGTTGG + Intronic
951206124 3:19927414-19927436 GAAACTTTTCCTTCCTGCACTGG + Intronic
951907330 3:27718003-27718025 GAAACTTTTTCTTGCATGGTGGG - Intronic
952366177 3:32676992-32677014 GACACTCGTCCTTCCTTGGAAGG + Intergenic
953364767 3:42334423-42334445 GAAAATTTTTCTTGTTTGGTAGG + Intergenic
955750908 3:62184744-62184766 GAAACTGCTGCTTCCTGGGTGGG - Intronic
955816246 3:62846498-62846520 GAAACTTCTCCTTATCTGGTTGG + Intronic
956404921 3:68918200-68918222 GAATGTGTTCCTTCCTTGTTCGG - Intronic
957691184 3:83572251-83572273 GAAACTTTTACACCGTTGGTGGG - Intergenic
959003476 3:100992263-100992285 AAAACTGTTCTTTCCTCGGTGGG - Intronic
960425939 3:117508051-117508073 TAAACTTTCCTTTCCTTGGTAGG - Intergenic
960494805 3:118361166-118361188 GCAATTTTTCCTTCCTTAGAAGG + Intergenic
962953236 3:140240886-140240908 GAACCTTTTTCTTCCTGGATGGG + Intronic
963223331 3:142834919-142834941 AGAACTTTTCCTTCCTTGACAGG + Intronic
964272086 3:154967551-154967573 GAAACTTTTTCTCCCTTGAAAGG + Intergenic
965609761 3:170531578-170531600 GGACCATTTCCTTTCTTGGTAGG + Intronic
967612055 3:191518840-191518862 GAAAATTTCCCTTCCTTTCTTGG - Intergenic
968589654 4:1450983-1451005 GGACCTCTTCCCTCCTTGGTGGG + Intergenic
971637875 4:29086760-29086782 GAAAGATTTCTTTCCTTTGTTGG + Intergenic
971773702 4:30932302-30932324 GAAGCATTTCTTTCCTTGGATGG - Intronic
973262276 4:48177316-48177338 GTTACTTTTTCTTCATTGGTAGG + Intronic
974014534 4:56636682-56636704 CAAACTCTTCCTTCCTTACTGGG - Intergenic
977077038 4:92467647-92467669 GATGCTTTTCCATACTTGGTTGG - Intronic
980135125 4:128851348-128851370 AAAAATTTGCCTTTCTTGGTAGG - Intronic
982785844 4:159535907-159535929 GGAAGTTTTTCTTCCTTGGCTGG + Intergenic
984231820 4:177109538-177109560 GAAACTGTTTCTTCAGTGGTTGG - Intergenic
985827385 5:2203015-2203037 GAAACATTTCCTTCCTTTCATGG + Intergenic
986003736 5:3650341-3650363 GAAGCTGATGCTTCCTTGGTTGG + Intergenic
988809188 5:34767822-34767844 GAAACAATTCCTTTCTTAGTAGG - Intronic
988929765 5:36026378-36026400 GTGACTTTTCCTTTCTAGGTAGG - Intergenic
988981008 5:36569264-36569286 TAAAATCTTTCTTCCTTGGTAGG + Intergenic
990322337 5:54642166-54642188 GGAACTTTTTTGTCCTTGGTCGG + Intergenic
991252097 5:64574428-64574450 GATACTTTTGCTTCCTATGTTGG + Intronic
992318989 5:75592314-75592336 GATTTTTTTCCTTCCTTTGTAGG + Intronic
992526867 5:77620085-77620107 GAAAATATTCTTTCTTTGGTAGG - Intronic
993829403 5:92735919-92735941 GCATCTTTTCCTTCCTTTTTAGG + Intergenic
994339544 5:98610207-98610229 CAAACTTGTCCTTCCTTTGAGGG + Intergenic
994472371 5:100224245-100224267 CAAATTTTGCCTTCCTTGGCAGG + Intergenic
995273071 5:110245124-110245146 GATACTCTTCCTTCCCTCGTAGG + Intergenic
997380990 5:133437952-133437974 CCAACTTTTCTTTCTTTGGTTGG + Intronic
998532190 5:142895524-142895546 GAAAAGTCTCCTTTCTTGGTCGG - Intronic
999545234 5:152621929-152621951 GAAATGTTTCGTTCCTTTGTAGG + Intergenic
1001872627 5:175170020-175170042 GAAACATTCCCTTCTTTGGCCGG - Intergenic
1005936135 6:30522412-30522434 GAATGTTTTCCTGCCTTGCTAGG - Intergenic
1006244577 6:32719614-32719636 AAACCTTTTCCTTTCATGGTTGG - Intergenic
1006942199 6:37759976-37759998 GAAACTATTTCTTCTTTGCTGGG - Intergenic
1009827030 6:68879782-68879804 GTAACTCTGCCCTCCTTGGTTGG - Intronic
1009940759 6:70285008-70285030 TAAACTTTCCCTTCCTCTGTGGG - Intronic
1010291973 6:74147838-74147860 GAAACTTTTCCTTTTTTGGTTGG - Intergenic
1012337112 6:98073860-98073882 GAAAGTTTTGCTTCATTAGTGGG + Intergenic
1012519257 6:100100943-100100965 GAAGCTTTCCCTTCCTCAGTAGG - Intergenic
1015457435 6:133443130-133443152 AACACTTTTCATTCCATGGTAGG - Intronic
1016007499 6:139104683-139104705 AATAATTTTCCTTCCTTGTTTGG - Intergenic
1016492591 6:144623797-144623819 GAAAATTATCCTGCATTGGTAGG + Intronic
1017439800 6:154453737-154453759 GAGGCTTTTCCCTCCTTTGTGGG - Intronic
1020679188 7:11215757-11215779 GAAGCATTTCCTTGTTTGGTAGG - Intergenic
1025218366 7:57080748-57080770 TAAACTTTTCTTTCTTTGGGAGG + Intergenic
1025629285 7:63254367-63254389 TAAACTTTTCTTTCTTTGGGAGG + Intergenic
1025652980 7:63489713-63489735 TAAACTTTTCTTTCTTTGGGAGG - Intergenic
1026332997 7:69369278-69369300 TAAAATTTTCCCTCCTTGCTTGG - Intergenic
1031011580 7:116529277-116529299 CCAACTTTTCCTTACTTGATTGG - Intronic
1031072742 7:117180059-117180081 GAAACTTTTGTCTCCTGGGTGGG + Intronic
1032562140 7:132903346-132903368 GAATATTTTCAATCCTTGGTTGG + Intronic
1033520620 7:142156898-142156920 GAAAATTTTCCGTCAATGGTCGG - Intronic
1034540332 7:151754357-151754379 CATACTTTTCCTTTCTTTGTGGG + Intronic
1036410401 8:8494586-8494608 GGACATTTTCCTTCCTTGGGTGG - Intergenic
1037742407 8:21618060-21618082 GAAGCTCTTCCCTCCATGGTGGG - Intergenic
1041657808 8:60371200-60371222 GCAAGGTTTCCTTCCTTGGGTGG - Intergenic
1042110425 8:65375840-65375862 GGAACTCTTCCTTCCTAAGTGGG + Intergenic
1043479369 8:80637816-80637838 GAAAAGTTTTCTCCCTTGGTTGG - Exonic
1044184995 8:89240237-89240259 GCCCCTTCTCCTTCCTTGGTCGG + Intergenic
1046274115 8:111934239-111934261 GAAACTTTGCCTCCCTTGAATGG - Intergenic
1047745366 8:127840782-127840804 CCAACTTTTCATTCCCTGGTTGG - Intergenic
1048574004 8:135676816-135676838 GCAATTTTTCATTCCTTTGTGGG - Intergenic
1050365093 9:4866672-4866694 GATTCTTTTCCTTTCTTGGTGGG - Intronic
1051011100 9:12415583-12415605 CAACCTTTTTTTTCCTTGGTTGG - Intergenic
1052427265 9:28321819-28321841 GAAACTATCTCTTCATTGGTGGG - Intronic
1054788536 9:69233275-69233297 GAAACTTATCCTTAGTTGGGTGG - Intronic
1058264199 9:102877059-102877081 ACAATTTTTCCTTTCTTGGTAGG - Intergenic
1058686411 9:107485216-107485238 AAAACTTTGGCTTCCTTGTTTGG + Exonic
1058972101 9:110093201-110093223 GAAACTTTTGCTTATTTGGAAGG - Intronic
1059559120 9:115315064-115315086 GAATCTTTATCTTCCTTGCTTGG - Intronic
1059849162 9:118317845-118317867 GAAACTTTTCCTTTCTGTGTAGG - Intergenic
1060559699 9:124532937-124532959 GAAACTTTTCCTTCCTTGGTAGG - Intronic
1186829055 X:13372256-13372278 TAAACTTTTACTTCATTGGAGGG + Intergenic
1188349272 X:29107447-29107469 GAGACTTTTCCTGCCTTATTGGG + Intronic
1188576839 X:31661800-31661822 GAAACATTTCTTTCCTGGTTGGG - Intronic
1189060253 X:37746095-37746117 GAAACTTGCCCTTCCTGGTTTGG - Intronic
1189370326 X:40422976-40422998 GAGCTTTTTCCTTCCTTGTTGGG + Intergenic
1189635544 X:43004650-43004672 GAAGCTTTTCCCTCTTTGGCCGG + Intergenic
1190199680 X:48350085-48350107 GAAACATTTCCTTCCTCTGCTGG + Exonic
1190416750 X:50187690-50187712 AAAACTTTGCTTTCCTTGTTTGG + Intergenic
1190982090 X:55465094-55465116 CAATCTTTTCCTATCTTGGTAGG - Intergenic
1190986608 X:55508088-55508110 CAATCTTTTCCTATCTTGGTAGG + Intergenic
1192953016 X:76038136-76038158 GAATGTTTGCCTTCCTTGCTAGG + Intergenic
1193287437 X:79729393-79729415 GAAACTTTTTATTCCTGGGTAGG + Intergenic
1194100799 X:89701265-89701287 GCACCTTTTTCTTCCCTGGTAGG - Intergenic
1194130641 X:90076989-90077011 GAAACTCTTTCTTCCTTGACTGG - Intergenic
1194749666 X:97670443-97670465 AAAGCTGTTCCTTCCTTGGATGG - Intergenic
1195404957 X:104502737-104502759 AAATCTTTTCTTTCTTTGGTGGG - Intergenic
1195792695 X:108606624-108606646 AATACTTTTCCTTCCATGGGGGG - Intronic
1196382731 X:115109748-115109770 GAAATCTTCCCTTCCTTGTTGGG + Intergenic
1199510672 X:148618397-148618419 GAAGCTTTTCCCCCTTTGGTCGG - Intronic
1200453751 Y:3362352-3362374 GCACCTTTTTCTTCCCTGGTAGG - Intergenic