ID: 1060559700

View in Genome Browser
Species Human (GRCh38)
Location 9:124532941-124532963
Sequence TGAGGAAACTTTTCCTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 345}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060559700_1060559706 23 Left 1060559700 9:124532941-124532963 CCAAGGAAGGAAAAGTTTCCTCA 0: 1
1: 0
2: 1
3: 27
4: 345
Right 1060559706 9:124532987-124533009 TGCCTTGGTCTTGGGGCTTAAGG No data
1060559700_1060559702 8 Left 1060559700 9:124532941-124532963 CCAAGGAAGGAAAAGTTTCCTCA 0: 1
1: 0
2: 1
3: 27
4: 345
Right 1060559702 9:124532972-124532994 GCTGTTACTGACTTCTGCCTTGG No data
1060559700_1060559705 16 Left 1060559700 9:124532941-124532963 CCAAGGAAGGAAAAGTTTCCTCA 0: 1
1: 0
2: 1
3: 27
4: 345
Right 1060559705 9:124532980-124533002 TGACTTCTGCCTTGGTCTTGGGG No data
1060559700_1060559704 15 Left 1060559700 9:124532941-124532963 CCAAGGAAGGAAAAGTTTCCTCA 0: 1
1: 0
2: 1
3: 27
4: 345
Right 1060559704 9:124532979-124533001 CTGACTTCTGCCTTGGTCTTGGG No data
1060559700_1060559707 24 Left 1060559700 9:124532941-124532963 CCAAGGAAGGAAAAGTTTCCTCA 0: 1
1: 0
2: 1
3: 27
4: 345
Right 1060559707 9:124532988-124533010 GCCTTGGTCTTGGGGCTTAAGGG No data
1060559700_1060559703 14 Left 1060559700 9:124532941-124532963 CCAAGGAAGGAAAAGTTTCCTCA 0: 1
1: 0
2: 1
3: 27
4: 345
Right 1060559703 9:124532978-124533000 ACTGACTTCTGCCTTGGTCTTGG No data
1060559700_1060559709 29 Left 1060559700 9:124532941-124532963 CCAAGGAAGGAAAAGTTTCCTCA 0: 1
1: 0
2: 1
3: 27
4: 345
Right 1060559709 9:124532993-124533015 GGTCTTGGGGCTTAAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060559700 Original CRISPR TGAGGAAACTTTTCCTTCCT TGG (reversed) Intronic
900346500 1:2212943-2212965 TGCAGGGACTTTTCCTTCCTCGG + Intergenic
900557112 1:3286171-3286193 TGAGGGAACATTTCCTTCAGGGG - Intronic
902052091 1:13571742-13571764 GGAGGAAACTTAGCGTTCCTTGG + Intergenic
906254656 1:44338972-44338994 GGAGGATAGTTTTGCTTCCTGGG - Intronic
906748925 1:48241604-48241626 AAATGAAACTTTTACTTCCTTGG - Intronic
910808014 1:91207927-91207949 GGAGGAAACTTAGCATTCCTTGG - Intergenic
911366934 1:96949823-96949845 AGAGGAAATTTTTGCTTCCATGG - Intergenic
911794241 1:102056138-102056160 TGAGGAAAATTTTCCTGGCCTGG + Intergenic
912426736 1:109599975-109599997 TGAAGATACTCTTCCTTCCTGGG + Exonic
912980351 1:114365554-114365576 GGAGGAAACTTAGCATTCCTTGG - Intergenic
916165973 1:161967731-161967753 TGAGTGGCCTTTTCCTTCCTTGG - Intergenic
916681257 1:167107229-167107251 TGAGGGAAGCTTTCCTTCTTTGG - Intronic
918246218 1:182661744-182661766 TGAGGAAACTTTGCTCTCTTGGG + Intronic
918879141 1:190091857-190091879 TGAGGAAACTTTTTCTAGATGGG - Intergenic
919046180 1:192455319-192455341 TAAGGAAAGTTTTTCTTCCAGGG - Intergenic
919552648 1:199011122-199011144 TCAGCATGCTTTTCCTTCCTTGG + Intergenic
920057744 1:203205199-203205221 AGAGGAAACTTGTCCTTTCTTGG - Intergenic
920575840 1:207059740-207059762 TTAGGAAACTTTTCCTTCCGAGG + Intronic
921822157 1:219629629-219629651 TGGGCAAACATTTCCTTCCCTGG - Intergenic
921927215 1:220721332-220721354 GGAGGAAACTTAGCATTCCTTGG + Intergenic
923142718 1:231174708-231174730 TGAAAAAACTCTTTCTTCCTGGG - Intronic
924859005 1:247901925-247901947 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1063382186 10:5592336-5592358 TCCGGAAACTTTCTCTTCCTCGG + Intergenic
1064756555 10:18576675-18576697 GGAGGAAACTTAGCATTCCTTGG + Intronic
1065288600 10:24208764-24208786 TGTGAAATGTTTTCCTTCCTCGG + Intronic
1065437830 10:25719965-25719987 TGACAACTCTTTTCCTTCCTAGG + Intergenic
1065931078 10:30479590-30479612 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1066173573 10:32879260-32879282 TGAGGAAACTTGTCCTGCTATGG - Intronic
1066535649 10:36388241-36388263 TTTGGGCACTTTTCCTTCCTGGG - Intergenic
1068671730 10:59730071-59730093 GGAGGAAACTTAACATTCCTTGG - Intronic
1068675732 10:59767548-59767570 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1068840111 10:61602985-61603007 AGAGGAAAATTCTTCTTCCTTGG - Intergenic
1070372377 10:75794977-75794999 TAAGAAACCTTTGCCTTCCTTGG + Intronic
1072270167 10:93768580-93768602 AGTGGAAACTCTTCCTTTCTAGG - Intronic
1072334867 10:94388994-94389016 AGAGGAAACTTAGCATTCCTAGG + Intergenic
1072485427 10:95850025-95850047 TGAGCAAACCTTTCCTCCTTAGG + Intronic
1073834527 10:107425822-107425844 TGAGGAAAGCTTTCCTTGATAGG - Intergenic
1074426832 10:113358698-113358720 TGAGGAAGCTCTGCCTTACTTGG - Intergenic
1078862919 11:15269450-15269472 AGAGGACAGTTTTCCTTCCTTGG + Intergenic
1079504451 11:21137754-21137776 AGAGGAAACATTTTCTTCTTAGG + Intronic
1079902134 11:26199704-26199726 TGAGGAAACATTTTCTTCAGTGG + Intergenic
1081067399 11:38562618-38562640 TGAGCAAACTTTTCATTCAATGG + Intergenic
1081660666 11:44886097-44886119 TCAGGAAACTTGCCCTCCCTGGG + Intronic
1082271994 11:50182496-50182518 TGAAAAATCTTTTCTTTCCTGGG + Intergenic
1082814350 11:57498517-57498539 TGAGTACACTTTTCCTCCCTGGG - Intronic
1082897809 11:58211614-58211636 GGAGAAATCTTTCCCTTCCTTGG + Intergenic
1084398211 11:68928724-68928746 TGCAGCAGCTTTTCCTTCCTGGG - Intronic
1085998810 11:81954349-81954371 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1086904795 11:92406050-92406072 TGAGAAAAATCTTCATTCCTTGG + Intronic
1087684577 11:101248682-101248704 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1089079571 11:115764512-115764534 TGAGGAGGCTTTTCCTTCACAGG + Intergenic
1090323751 11:125867229-125867251 GGAGGAAACTTAGCGTTCCTTGG - Intergenic
1091150416 11:133323509-133323531 TGCTGAAGCATTTCCTTCCTTGG - Intronic
1091331089 11:134731385-134731407 GGAGGAAACTGGTCTTTCCTTGG + Intergenic
1091557492 12:1585481-1585503 TGAGGAAATATTTCCTACCAAGG - Intronic
1091703011 12:2676425-2676447 AGAGGAAACATTTCATGCCTGGG - Intronic
1091814446 12:3425945-3425967 GGAGGAAACTTAACGTTCCTTGG - Intronic
1092129529 12:6099342-6099364 TTAACAAACTTTTGCTTCCTTGG - Intronic
1092727983 12:11502770-11502792 AGAGAGAACTTTTCCTTCTTTGG + Intergenic
1093137710 12:15472083-15472105 TGAGCAGCCTATTCCTTCCTAGG + Intronic
1093594050 12:20940648-20940670 GGAGGAAACTTAGCGTTCCTTGG - Intergenic
1094301114 12:28966322-28966344 TAAGAAATCTTTTTCTTCCTGGG + Intergenic
1095162250 12:38932426-38932448 GGAGGAAACTTTGTGTTCCTTGG - Intergenic
1096616586 12:52836513-52836535 GGAGGAAACTGCTCCTCCCTGGG - Intergenic
1097571298 12:61335359-61335381 TGAAGCTATTTTTCCTTCCTAGG + Intergenic
1097769359 12:63563580-63563602 TGAGACAACTTTGCATTCCTGGG + Intronic
1098012234 12:66065844-66065866 AGAGGAAAATTCTCATTCCTGGG + Intergenic
1099260267 12:80371567-80371589 TGAAAAAATATTTCCTTCCTTGG - Intronic
1099952728 12:89322567-89322589 TCTTGAAACTTTTTCTTCCTTGG - Intergenic
1100123925 12:91400534-91400556 TGAGAAAACTTTACCTTATTAGG - Intergenic
1100146285 12:91681733-91681755 TGAGTCCACTTTTCCTACCTTGG - Intergenic
1101367377 12:104086708-104086730 TGAGTAAACTTTCCCTGTCTTGG + Intronic
1101924131 12:108957122-108957144 TGTGGAAGCTTTCCCTCCCTGGG - Intronic
1102321547 12:111939852-111939874 TGAAGATACTTTTTCTTCTTTGG - Intronic
1105972689 13:25445212-25445234 TAAGAAAACTTTGCCTCCCTTGG + Intronic
1107810315 13:44194026-44194048 TCTGGAGACTTCTCCTTCCTCGG + Intergenic
1108005332 13:45940549-45940571 TGAGGAAAATTTCTCTTTCTAGG + Intergenic
1109331622 13:60937819-60937841 TGATGAATCATTTTCTTCCTGGG + Intergenic
1109776634 13:67049457-67049479 TGAGAAAACTGTTCATTGCTGGG - Intronic
1109909388 13:68890204-68890226 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1110582516 13:77147864-77147886 TAAGGAAAATTTCCTTTCCTGGG + Intronic
1111372895 13:87339979-87340001 TAAAGAAAATTTTCCTTCCCCGG - Intergenic
1111681027 13:91441559-91441581 AGAGGAAGCTTTGCTTTCCTGGG + Intronic
1111792976 13:92882108-92882130 CGTGGAAACTTTTTTTTCCTAGG - Intergenic
1111826767 13:93277056-93277078 TGAGGAAAAATTTCCCTCCCTGG - Intronic
1113999798 14:16403458-16403480 TGAGCAAACATTTCCTTGATTGG + Intergenic
1114223404 14:20717032-20717054 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1114235967 14:20824142-20824164 GGAGGAAACTTAGCGTTCCTTGG - Intergenic
1114357321 14:21925575-21925597 TGAGCAAACTTTCCATTCCATGG + Intergenic
1115211487 14:30971082-30971104 GGAGGAAACTTAGCGTTCCTTGG + Intronic
1115771209 14:36665204-36665226 AAAGAAAACTTTTCCTGCCTAGG + Intronic
1116030533 14:39565893-39565915 TTAAGAAACTTTTCCTTCATAGG + Intergenic
1116390025 14:44380589-44380611 TCAGTACAGTTTTCCTTCCTAGG + Intergenic
1116893006 14:50287079-50287101 TGAAGAAACTTTACTTTCCCAGG - Intronic
1117179424 14:53177177-53177199 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1117677675 14:58171068-58171090 GGAGGAAGGTTTTCCTGCCTTGG - Intronic
1118607037 14:67512141-67512163 TGGGGAAATTTTCCTTTCCTGGG - Intronic
1119678194 14:76572144-76572166 TGGGGATTCTTCTCCTTCCTGGG + Intergenic
1120288268 14:82533462-82533484 TCAGGAGACTTTACCTCCCTTGG + Intergenic
1121369341 14:93342435-93342457 TGAAGCCATTTTTCCTTCCTAGG + Intronic
1121878735 14:97479858-97479880 TCAGGAAACTTTTGATTCTTCGG + Intergenic
1125425104 15:39540688-39540710 AAAGGAAACTTTTGCTTTCTTGG + Intergenic
1125690438 15:41591759-41591781 GGAGGAAACTTAGCGTTCCTTGG + Intergenic
1126658866 15:51011411-51011433 TCAGGAAATTTTTCCTTGATAGG + Intergenic
1127648303 15:60980200-60980222 TGAACAAACTTTGCATTCCTGGG + Intronic
1130541022 15:84820941-84820963 TGAGGAGACCTTTCCTTTCTGGG + Intronic
1130784917 15:87085474-87085496 AGAGCAAATTTGTCCTTCCTTGG + Intergenic
1131563033 15:93460697-93460719 AGAGGTCACTTATCCTTCCTGGG + Intergenic
1132472287 16:112124-112146 TGAAGAAACTATTACTCCCTGGG - Intronic
1133420642 16:5643425-5643447 TCAGGAAACCTTGTCTTCCTTGG - Intergenic
1133822383 16:9248184-9248206 TGTGGAAGCTTTTCATTACTTGG - Intergenic
1133840773 16:9407378-9407400 GGATTAAACATTTCCTTCCTCGG - Intergenic
1138083772 16:54115622-54115644 TCAGGGCCCTTTTCCTTCCTTGG - Exonic
1138258248 16:55589522-55589544 TGAGGAAACTTTTCTGTCTTGGG + Intergenic
1139070018 16:63369216-63369238 TAAGGAAGCCTTTCTTTCCTAGG + Intergenic
1140869007 16:79089805-79089827 GAAGGAACCTTTTCATTCCTCGG + Intronic
1140971261 16:80015183-80015205 TGAAGAAACTTATACCTCCTAGG + Intergenic
1141770461 16:86086769-86086791 AGAAGAAACCTATCCTTCCTTGG + Intergenic
1142537756 17:631558-631580 TGAAGAAGCGTTTCCTTCCCAGG - Exonic
1142729426 17:1841923-1841945 TGAGTAAACCTTGCCTTCCTTGG + Intronic
1144093856 17:11882190-11882212 TGAGGCCTCTTTTCCTGCCTTGG + Intronic
1144738661 17:17569018-17569040 AGAGGCAGCTTTTCCTTTCTGGG - Intronic
1145086405 17:19945168-19945190 TCAGAAGACTTTTCCTTCATGGG + Intronic
1146469945 17:33116103-33116125 TGGGGACAGTTTACCTTCCTAGG + Intronic
1146764232 17:35504757-35504779 GGAGGAAACTTAGCCTTCTTTGG + Intronic
1147810241 17:43163798-43163820 GGAGGAAACTTAGCGTTCCTTGG - Intergenic
1147911871 17:43860933-43860955 TGAGACAGCTTGTCCTTCCTTGG + Intronic
1147997846 17:44370890-44370912 TGAGGGATTTGTTCCTTCCTGGG - Intergenic
1149340378 17:55680011-55680033 TGAGGAACAGCTTCCTTCCTGGG - Intergenic
1152455009 17:80409896-80409918 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1152978703 18:251429-251451 TAAGGAAAATTTTCCTTCACTGG - Intronic
1153179696 18:2419147-2419169 TGAGGATAGTTGTCCTGCCTGGG - Intergenic
1153276502 18:3372974-3372996 TGAGAAAACTGTTCCATCATAGG - Intergenic
1153284089 18:3441576-3441598 TGTGGCAATTTTTCCTTCCAGGG - Intronic
1153615206 18:6927870-6927892 TTAAGAAACCTTTCCTTCGTGGG - Intergenic
1153830442 18:8917738-8917760 GGAGGAAACTTTGCATTTCTTGG + Intergenic
1154334674 18:13456017-13456039 TTAGGAAACGTGTCCTTGCTTGG + Intronic
1155101134 18:22611282-22611304 GCAGCAAACTTTTCTTTCCTGGG - Intergenic
1155880546 18:31143175-31143197 TGAGTAAACTTTTCCTTAGGCGG - Intronic
1156623926 18:38885859-38885881 TGAGGAAAATTTTTATTTCTTGG - Intergenic
1157824435 18:50800192-50800214 CTAGGATACTTTTCCTTGCTTGG - Intronic
1158882853 18:61797654-61797676 TGAGCAAACTTTTATTTTCTGGG - Intergenic
1159103385 18:63979477-63979499 TGGGTGAATTTTTCCTTCCTGGG + Intronic
1159357986 18:67360638-67360660 GGAAGAAACATTTCCTCCCTCGG - Intergenic
1160683776 19:424208-424230 GGAGGAGGCTTGTCCTTCCTTGG - Intronic
1160733630 19:652104-652126 GGAGGAAATTTTTCCCTCCAGGG - Intronic
1162821374 19:13225493-13225515 TGGGGAATCTTTTCTTCCCTGGG - Intronic
1163991918 19:21006772-21006794 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1164121500 19:22269455-22269477 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1164216895 19:23158448-23158470 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1164945502 19:32289936-32289958 TGAGTCAAAATTTCCTTCCTTGG + Intergenic
1165219451 19:34303293-34303315 TAAGGAACATTCTCCTTCCTAGG - Intronic
1167906954 19:52668993-52669015 GGAGGAAACTTAACATTCCTTGG + Intronic
1168602436 19:57728499-57728521 TCAGAAAACTCTTCCTGCCTGGG + Intronic
925018871 2:553235-553257 AAAGGACACTTTTCCTTGCTGGG + Intergenic
925615848 2:5744008-5744030 TGGGGAAACTTCTCCCTCCGTGG - Intergenic
925781998 2:7389681-7389703 TGAAGCCACTTTTTCTTCCTAGG + Intergenic
926737098 2:16082053-16082075 TGAAGACACTATTCTTTCCTGGG + Intergenic
926945094 2:18178728-18178750 CCAGGAAACATTTCTTTCCTTGG + Intronic
927183881 2:20468231-20468253 TGGGGAAGCTGTTGCTTCCTAGG + Intergenic
927512005 2:23649756-23649778 GGTGGGAACATTTCCTTCCTGGG + Intronic
930305167 2:49667242-49667264 TGACCATACTTTTCCTTACTGGG - Intergenic
930725083 2:54674553-54674575 TGAGGACTCTTGTCTTTCCTGGG + Intergenic
932645894 2:73501505-73501527 TGAGGATCATTTTCTTTCCTAGG + Intronic
932657900 2:73626306-73626328 TGACGACAGGTTTCCTTCCTGGG - Intergenic
932664580 2:73686645-73686667 TGACGACAGGTTTCCTTCCTGGG - Intergenic
934499683 2:94847437-94847459 TGAAGAAAGATTGCCTTCCTTGG + Intergenic
935048484 2:99503065-99503087 GGAGGAAACTTAGCATTCCTTGG + Intergenic
935183369 2:100709532-100709554 TGCTGAAACATTTCCTCCCTTGG + Intergenic
935852140 2:107234669-107234691 TAAGGATAATTTTCCTTCTTTGG - Intergenic
937449411 2:121989461-121989483 TGAGGAAACTTTCACTTTCTTGG + Intergenic
937905993 2:127053087-127053109 TGAGGACACTCGTCCATCCTGGG + Intronic
938588406 2:132714229-132714251 TGAGGGAAGTTTACCTTTCTGGG + Intronic
938648524 2:133355759-133355781 TGAGGAAACTATGCTTTCCTAGG - Intronic
938904594 2:135826029-135826051 AGAGCACACTGTTCCTTCCTGGG - Intronic
941429940 2:165401694-165401716 TGAGAAAAGATTTCTTTCCTTGG + Intergenic
941715663 2:168760665-168760687 TGAGGAAACTGTTCTTTTTTTGG - Intronic
944731338 2:202520772-202520794 TGAAGAAAGTTTGCCTACCTGGG + Intronic
947190815 2:227502891-227502913 TGAAAACACTTTTCTTTCCTCGG + Intronic
947556484 2:231097998-231098020 GGAGGAAACTTAGCATTCCTTGG - Intronic
947652602 2:231799566-231799588 TGAGGAAACTTTTAGCTTCTTGG + Intronic
948437231 2:237961960-237961982 AGAGGCCACTTTTCCTGCCTGGG + Intergenic
948722685 2:239911452-239911474 TCAGGCAACTTCTCCTTTCTTGG - Intronic
1169566690 20:6861724-6861746 TGTGGAAATTTTACCTCCCTTGG + Intergenic
1169635754 20:7689710-7689732 TGAGGCAAATTTTCCTTCAGAGG - Intergenic
1169765056 20:9139995-9140017 TGAGATAACTTTTCTTTCCATGG + Intronic
1169843209 20:9962185-9962207 TAAGGGATCTTTTCCTTCCTGGG + Intergenic
1169918969 20:10713148-10713170 TGAGAAAACAATTCCTTCATAGG - Intergenic
1169919454 20:10718873-10718895 TGGGGAATGTATTCCTTCCTGGG - Intergenic
1171220198 20:23389922-23389944 TGAGGATACTGTTGTTTCCTTGG - Intronic
1171881461 20:30620709-30620731 TGAGTGAACTTCTCCTGCCTTGG + Intergenic
1173890902 20:46509461-46509483 TGAGGAAACTTGCCCCTCTTTGG - Intronic
1174679357 20:52390366-52390388 TGATGAAACTTTTCTTACCTGGG + Intergenic
1175138783 20:56844165-56844187 TGAGGAAACTGTTCCCTTTTGGG + Intergenic
1175924877 20:62466726-62466748 AAAGGTAACTTTACCTTCCTGGG + Intronic
1176601916 21:8801973-8801995 TGAGTGAACTTGTCCTGCCTTGG + Intergenic
1176820703 21:13652479-13652501 TGAGTAAGCTTGTCCTGCCTGGG - Intergenic
1178007640 21:28240899-28240921 TGAGCTAACTTTTCCCTCTTTGG + Intergenic
1178133855 21:29603939-29603961 AGAGGCAACTTTTCCTTTATGGG + Intronic
1178229758 21:30768319-30768341 CGTGGATACTTTTCCTTACTAGG - Intergenic
1178837174 21:36108462-36108484 GGAGGAAACTTAGCGTTCCTTGG + Intergenic
1180344201 22:11693524-11693546 TGAGTGAACTTGTCCTGCCTTGG + Intergenic
1182759079 22:32707557-32707579 TAAGTAAACTTTATCTTCCTGGG + Intronic
1184630953 22:45779279-45779301 TGAGGATAATTTTCTTTCTTGGG + Intronic
1184866719 22:47205500-47205522 TGAGGCTACTTTCCCTCCCTGGG + Intergenic
1184972117 22:48031178-48031200 TGATGAAACTCTTCTTTCCTCGG + Intergenic
949980343 3:9498878-9498900 TCAGGAAAGTTTTCCTTCATGGG + Exonic
950846028 3:16017003-16017025 GGAGGAAACTTAGCATTCCTTGG - Intergenic
951046428 3:18044285-18044307 TGAGGCAGGTTGTCCTTCCTGGG - Intronic
951248483 3:20367578-20367600 GGAGGAAACTTAGCATTCCTTGG - Intergenic
951667604 3:25144552-25144574 TAGGGAAACTTTTCCTTTTTTGG - Intergenic
951907332 3:27718007-27718029 GGAGGAAACTTTTTCTTGCATGG - Intronic
952563289 3:34621774-34621796 TGAACAAACTTTTCATTCCTGGG + Intergenic
954369040 3:50160729-50160751 TGGGGTGACCTTTCCTTCCTCGG + Intronic
954604860 3:51901392-51901414 GGAGGAAACTTAGCATTCCTTGG + Intronic
955341942 3:58131662-58131684 AGAGGAACCTTCTCCTTCATGGG + Intronic
955476975 3:59347352-59347374 TGAGACAACTTTTCATTTCTGGG + Intergenic
956376075 3:68614964-68614986 TGGGGATACTTTTGCTTCCCAGG - Intergenic
956419484 3:69071637-69071659 TGAGGAAACTTCTGCTTAATTGG - Intronic
957999849 3:87737170-87737192 GGAGGAAACTTAGCATTCCTTGG - Intergenic
959956296 3:112242006-112242028 TGTGGAAACATTTATTTCCTGGG - Intronic
960045471 3:113193305-113193327 TGAGGAAAATTTTCTTGCATGGG + Intergenic
960058510 3:113294808-113294830 TGAGCAATCTTTTCCTACCAGGG + Exonic
960222845 3:115135379-115135401 TGAGGAAACTATTGATTCTTAGG - Intronic
960559826 3:119072062-119072084 TTAGGCAACTTTTCTTTTCTTGG - Intronic
962096679 3:132299669-132299691 GGAGGAAACTTAGCATTCCTTGG - Intergenic
962097436 3:132306794-132306816 GGAGGAAACTTAGCATTCCTTGG + Intergenic
962275305 3:134008803-134008825 TGTGGAGCCTTTTCCTTTCTGGG - Intronic
962720808 3:138173464-138173486 TGTGGATACTTTTTTTTCCTGGG - Intronic
963741646 3:149087109-149087131 TAAGGAAAATTTTCCTTTCTTGG + Intergenic
964420609 3:156498749-156498771 TGAGCAAAGTTTTCTTTCCATGG + Intronic
965735353 3:171813726-171813748 CTAGGAAACTTTTACTTCCTAGG + Intergenic
966446613 3:180007869-180007891 TGAGGCCACCTTTTCTTCCTGGG + Intronic
966798208 3:183736647-183736669 TCAGGAAACTTTTCCTGTGTAGG + Intronic
967019203 3:185507641-185507663 TGAGGAATCCTTTGCTTCCCTGG - Exonic
967248868 3:187516657-187516679 TGATGCAAGGTTTCCTTCCTTGG + Intergenic
967488315 3:190059453-190059475 TGGGGATCCTTTTCCTTCCTGGG + Intronic
969199151 4:5588085-5588107 TGCTGAAAGTTTTCCTTACTAGG - Intronic
969282864 4:6182907-6182929 TGAGGGACCTGTGCCTTCCTAGG - Intronic
970048562 4:11884237-11884259 TGAGGATTATTTTCCTCCCTGGG - Intergenic
970636296 4:18013248-18013270 TAAGGAATCTTAGCCTTCCTTGG - Intronic
970926299 4:21456372-21456394 TGAGGCAACTCTTCCTTGCTTGG + Intronic
972217120 4:36909763-36909785 GGAGGAAACTTAGCATTCCTTGG + Intergenic
972275008 4:37549128-37549150 GGAGGAAACTTAGCATTCCTTGG + Intronic
972590112 4:40477786-40477808 TGAGCAAATTTTTCCTGCCTTGG + Intronic
974534080 4:63152350-63152372 TGAGGAAACCTTTCCTCACCTGG - Intergenic
974949768 4:68573816-68573838 GGAGGAAACTTAGCATTCCTTGG - Intronic
975193791 4:71498699-71498721 TGTGGAAATTTTTCATTCCTTGG - Intronic
975911836 4:79276512-79276534 GGAGGAAACTTAGCATTCCTTGG + Intronic
978382980 4:108150016-108150038 TGAAGAAACTTTTCTTTCTAAGG - Intronic
978696698 4:111588855-111588877 AGAAGCAACTTTTCCTTCCCAGG + Intergenic
978999950 4:115204388-115204410 TGTGCAAACTTTACCTTCCTTGG - Intergenic
981038709 4:140199568-140199590 TAAGGCAACTTTCCATTCCTGGG + Intergenic
981038716 4:140199603-140199625 TAAGGCAACTTTCCATTCCTGGG + Intergenic
981038899 4:140202726-140202748 TAAGGCAACTTTCCATTCCTGGG - Intergenic
981985506 4:150849828-150849850 TGAAGAAAATTATCCTTACTGGG + Intronic
982038046 4:151365824-151365846 TAAGCCAACTTTTCATTCCTGGG + Intergenic
982906404 4:161080212-161080234 TGGAGAAATTTTTCTTTCCTAGG - Intergenic
985068867 4:186148854-186148876 TGGGGCAACTTTTCCTTCTCTGG + Intronic
985846165 5:2350542-2350564 TGAGCAAACTTTTCATTTCAGGG - Intergenic
986816592 5:11419168-11419190 GGAGGGAAGTTATCCTTCCTTGG - Intronic
987233710 5:15921556-15921578 TGAGCAAACTTTTTTTCCCTGGG - Intronic
988468126 5:31510700-31510722 TGAGGACAGGTGTCCTTCCTTGG - Intronic
988657216 5:33225585-33225607 TTAAGAAACTTCTCCTTCCCTGG + Intergenic
988789220 5:34591998-34592020 TGATAAATCTTTTTCTTCCTTGG - Intergenic
989961728 5:50423992-50424014 TGAAGAAAACTATCCTTCCTAGG - Intronic
993592255 5:89808624-89808646 TCAAGAAACTTATCCATCCTTGG - Intergenic
993879626 5:93347376-93347398 TGAGGAAACAGTGGCTTCCTCGG - Intergenic
994097229 5:95858116-95858138 TGAGGCAACTTTCCGTGCCTAGG - Intronic
994729001 5:103470154-103470176 AGGGGATACTTTTCCTTCCCGGG + Intergenic
996191442 5:120547521-120547543 TGAGGATAATTTGCCTTCCAAGG - Intronic
996766025 5:127034640-127034662 TGAGGAAAATTTTACTTACATGG + Intergenic
999053233 5:148546494-148546516 TCAGGAAACTTTTCCTGAGTAGG - Intronic
1000236891 5:159370263-159370285 GGAGGAAACTTAACATTCCTTGG + Intergenic
1000630591 5:163586398-163586420 TTAGGAAACTTATCCTGACTAGG + Intergenic
1000883834 5:166727816-166727838 AGAGGAAACTGTACATTCCTAGG + Intergenic
1000944804 5:167407903-167407925 TGAGGATGGTTTTCCTTTCTAGG - Intronic
1001558374 5:172652100-172652122 GGAAGAAACTTAGCCTTCCTTGG - Intronic
1004755210 6:18602999-18603021 GGAGGAAACTTTTGTTTCCCAGG + Intergenic
1005462003 6:26078140-26078162 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1005708178 6:28477866-28477888 TGAGGAAACAGGTCCTTTCTGGG + Intergenic
1006325707 6:33352287-33352309 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1006834356 6:36987724-36987746 ACAGGAACCTTTTCCTTCTTTGG + Intergenic
1007990119 6:46246423-46246445 TGAGGAAACAATTTCCTCCTGGG + Intronic
1008123534 6:47644569-47644591 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1008202786 6:48612978-48613000 TGACTAAACTTTTCATTCTTTGG - Intergenic
1009369315 6:62880719-62880741 AGAGGAGGCTTTTCCCTCCTTGG - Intergenic
1010317824 6:74470987-74471009 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1010945288 6:81966903-81966925 TGAGTAAAATTTTCCCTCATAGG - Intergenic
1011385549 6:86794053-86794075 TGAAGAGACTTGTCCTTTCTTGG + Intergenic
1012429971 6:99153918-99153940 CCTGGAAACTTCTCCTTCCTGGG - Intergenic
1012619862 6:101330105-101330127 TGAGCTAACTTTGTCTTCCTGGG + Intergenic
1012896065 6:104950982-104951004 TGAGGAAATTTTTCTTATCTAGG + Intergenic
1013134393 6:107266547-107266569 TGAGGAATTTTTTCCTTTTTAGG - Intronic
1013431660 6:110061750-110061772 GAAGGAAGCTTTCCCTTCCTTGG + Intergenic
1013646778 6:112150559-112150581 TAAGGGCACTTTTCCTTGCTAGG + Exonic
1014781833 6:125573645-125573667 TGAGGAAAGTTTTCCTCTTTGGG - Intergenic
1015132279 6:129826497-129826519 TCAGGAAACTTTACCTTTATGGG - Intergenic
1015422710 6:133029452-133029474 TTAGGCAACTTTGTCTTCCTTGG - Intergenic
1015671690 6:135698052-135698074 TAAGACAACTTTTCCTTGCTTGG - Intergenic
1017080193 6:150661069-150661091 TGAGGAAAGGTTTCCTCCCCTGG + Intronic
1018016439 6:159716485-159716507 TGAGAAAAATTTTCCTTCCGGGG - Intronic
1019113753 6:169739533-169739555 TGAGGAAAATTTTATTTCCCAGG - Intergenic
1019747325 7:2708279-2708301 TGAGGTGGCTTCTCCTTCCTGGG + Intronic
1020043824 7:5024776-5024798 GGAGGAAACTTAGCATTCCTTGG - Intronic
1020655852 7:10927272-10927294 GGAGGAAACTTAGCGTTCCTTGG + Intergenic
1021336200 7:19405566-19405588 TGATGAAAGGTTTCCTTCCATGG - Intergenic
1022367548 7:29739200-29739222 TGAGACAACTTTGCATTCCTGGG - Intergenic
1022928637 7:35084669-35084691 TGAGACAACTTTGCATTCCTGGG + Intergenic
1023983182 7:45081335-45081357 GGTGGAGACTTTGCCTTCCTGGG - Intronic
1024132448 7:46368259-46368281 TGAGGAAACTATTCTTTATTTGG + Intergenic
1026821611 7:73553337-73553359 TTAGGAACCTTTCCCTTTCTGGG + Intronic
1028259780 7:88648784-88648806 TGATGAAATTTATCCTTCCATGG + Intergenic
1029486160 7:100842990-100843012 GGAGGAAACTTAGCATTCCTTGG + Intronic
1029824749 7:103178347-103178369 TGAGACAACTTTGCATTCCTGGG + Intergenic
1030828440 7:114190360-114190382 AGAGAAAATTTATCCTTCCTTGG - Intronic
1031381691 7:121093769-121093791 TCTGGAAACTTCTCCTTCCTGGG + Intronic
1032170615 7:129581624-129581646 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1032979502 7:137265486-137265508 GGAGGAAACTTAGCATTCCTTGG - Intronic
1036410403 8:8494590-8494612 TGATGGACATTTTCCTTCCTTGG - Intergenic
1038089730 8:24239711-24239733 GGAGGAAACTTAGCGTTCCTTGG + Intergenic
1040638512 8:49303916-49303938 AGAGGCAACTTTTCATTCCCAGG + Intergenic
1041227201 8:55712434-55712456 GGAGGAAACTTAGCATTCCTTGG + Intronic
1041515535 8:58695245-58695267 GGAGGAAACTTAGCGTTCCTTGG + Intergenic
1042120986 8:65488091-65488113 TGAGAAAACTTTTCTTTACATGG + Intergenic
1042785351 8:72539347-72539369 TAAGGATACTTTTCCTTCAGTGG - Intronic
1044184472 8:89235638-89235660 GGAGGAAACTTAGCGTTCCTTGG - Intergenic
1044260356 8:90112774-90112796 CCAGGAAACTTTTCCTGCCACGG - Intergenic
1045697347 8:104824524-104824546 TGAGGAAACCCATCCTTCTTGGG - Intronic
1045808240 8:106190829-106190851 TGAAGAAACTTTTCTTTTTTGGG - Intergenic
1045934316 8:107661385-107661407 TGCCAAAACTTTTCCTTCCATGG - Intergenic
1048744968 8:137604286-137604308 TAAGGAGTCTGTTCCTTCCTGGG - Intergenic
1050287701 9:4119928-4119950 TGTGGCAAATTTTCCTTCCAAGG - Intronic
1050572996 9:6960850-6960872 TGAGGTGATTTTTGCTTCCTAGG - Intronic
1050905825 9:11004192-11004214 TAACGAAACTTTTCCTTACATGG + Intergenic
1051803797 9:20967794-20967816 TGAACAAACTTTGCATTCCTGGG + Intronic
1051902188 9:22055741-22055763 TGAAGATACTTTTCCTGGCTTGG + Intergenic
1051969432 9:22869498-22869520 TGAGGAAAGTCGTGCTTCCTAGG - Intergenic
1052075172 9:24132681-24132703 AGAAGATACTTTTCCTTCCCAGG + Intergenic
1052508153 9:29381290-29381312 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1052712215 9:32070345-32070367 TGTGGAAACTTGTACTTCTTTGG + Intergenic
1053047774 9:34934702-34934724 GAAGGGAACTTTTCCTTCCTTGG + Intergenic
1056901793 9:90606782-90606804 TGAGCAAACTTCTCCTTGCCTGG - Intergenic
1057384627 9:94596215-94596237 TGAGGAAACTAGGGCTTCCTAGG + Intergenic
1057506813 9:95640925-95640947 GGAGGAAAATTCTCCTTTCTTGG + Intergenic
1058037868 9:100273017-100273039 TGAGGAGATTTTTCCTGTCTCGG - Exonic
1058986191 9:110210271-110210293 TGAATAAACTTTCCTTTCCTTGG + Intergenic
1059249193 9:112872858-112872880 TGAGGAAAATGTTCTCTCCTGGG + Exonic
1060559700 9:124532941-124532963 TGAGGAAACTTTTCCTTCCTTGG - Intronic
1060715971 9:125929113-125929135 AGATGAAAATATTCCTTCCTTGG + Intronic
1203526653 Un_GL000213v1:97086-97108 TGAGTAAGCTTGTCCTGCCTGGG + Intergenic
1186154540 X:6711641-6711663 GGAAGAAACTTTTCCTTCCGAGG + Intergenic
1186558652 X:10587359-10587381 GGAGGAAACTTAGCATTCCTTGG - Intronic
1186653474 X:11587398-11587420 GAAAGAATCTTTTCCTTCCTTGG - Intronic
1187378813 X:18781490-18781512 CTAGAAAACTTTTCTTTCCTTGG - Intronic
1187937008 X:24345930-24345952 TGGGGAACCTTTTTTTTCCTCGG - Intergenic
1188706184 X:33334427-33334449 TGAGCAAACTTTTCCTATCGAGG + Intronic
1189030433 X:37443751-37443773 TAAGGAATCTTTTTCTTACTAGG - Intronic
1189404180 X:40704081-40704103 TGAAAAAAATTTTTCTTCCTGGG - Intronic
1189973758 X:46442637-46442659 TGAGGAGTCTTTTCCCTCCTTGG + Intergenic
1190270333 X:48858192-48858214 GGAGGAAACTTAGCATTCCTTGG + Intergenic
1190509211 X:51159950-51159972 TGAGGAATCTCATCCTGCCTGGG - Intergenic
1191917906 X:66222154-66222176 GGAGGAAACTTAGCATTCCTTGG - Intronic
1192074485 X:67978852-67978874 TGAGCCAACTTTTAATTCCTGGG - Intergenic
1192915405 X:75646277-75646299 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1193258535 X:79378609-79378631 AGAGCAAAATTTTCTTTCCTGGG - Intergenic
1193805753 X:85992271-85992293 TGGGGAAACTATTCATTTCTAGG + Intronic
1195846741 X:109237380-109237402 GGAGGAAACTTAGCATTCCTTGG - Intergenic
1196121585 X:112056937-112056959 TCAGAAAACATTTTCTTCCTTGG + Intronic
1197619451 X:128731567-128731589 TGAATGAACTTTTCCTACCTAGG - Intergenic
1198551974 X:137754872-137754894 TTTTGAAACTTTTCTTTCCTAGG + Intergenic
1198600997 X:138283939-138283961 TGAAGAATTTTTTCCTTGCTAGG + Intergenic
1198742548 X:139856356-139856378 GGAGGAAACTTATCACTCCTTGG + Intronic
1198946058 X:142015264-142015286 TAAGCAAACTTCTCATTCCTGGG + Intergenic