ID: 1060559701

View in Genome Browser
Species Human (GRCh38)
Location 9:124532959-124532981
Sequence CAGTAACAGCAGAAGTAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 220}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060559701_1060559703 -4 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559703 9:124532978-124533000 ACTGACTTCTGCCTTGGTCTTGG No data
1060559701_1060559707 6 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559707 9:124532988-124533010 GCCTTGGTCTTGGGGCTTAAGGG No data
1060559701_1060559709 11 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559709 9:124532993-124533015 GGTCTTGGGGCTTAAGGGACTGG No data
1060559701_1060559704 -3 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559704 9:124532979-124533001 CTGACTTCTGCCTTGGTCTTGGG No data
1060559701_1060559702 -10 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559702 9:124532972-124532994 GCTGTTACTGACTTCTGCCTTGG No data
1060559701_1060559706 5 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559706 9:124532987-124533009 TGCCTTGGTCTTGGGGCTTAAGG No data
1060559701_1060559710 25 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559710 9:124533007-124533029 AGGGACTGGCTACAGTGAGATGG No data
1060559701_1060559711 26 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559711 9:124533008-124533030 GGGACTGGCTACAGTGAGATGGG No data
1060559701_1060559705 -2 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559705 9:124532980-124533002 TGACTTCTGCCTTGGTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060559701 Original CRISPR CAGTAACAGCAGAAGTAGTG AGG (reversed) Intronic
901175581 1:7296452-7296474 CAGGAACTTCAGCAGTAGTGGGG + Intronic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
902306920 1:15547895-15547917 CAGTGACATGAGAGGTAGTGGGG - Intronic
902651816 1:17842368-17842390 AAGCAACAGAGGAAGTAGTGGGG - Intergenic
905996878 1:42388907-42388929 CACCAAGAGCAGAAGTAGGGAGG + Intronic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
907810092 1:57860708-57860730 CAATAACAGCATAAATATTGTGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
911729297 1:101276300-101276322 TAGTAACAGCAAAAGAAGTGGGG + Intergenic
911779968 1:101864102-101864124 CAGTAACAACTGAAGTTGTTAGG - Intronic
911852584 1:102838040-102838062 GAGTAAGAGCAGAAGTATTTTGG - Intergenic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912947744 1:114098748-114098770 TAGCAACAGCAGAAATAGAGAGG + Intronic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
915799770 1:158777762-158777784 CAGTAATAGTAATAGTAGTGAGG - Intergenic
915901824 1:159852635-159852657 AAGTATCAGGAAAAGTAGTGTGG - Intronic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
917199004 1:172496098-172496120 CAGTAAAAGCAGAAACTGTGAGG - Intergenic
917393543 1:174566225-174566247 CAGTAACTGGAGAGGAAGTGAGG + Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917820237 1:178755340-178755362 CACCACCAGCAGGAGTAGTGAGG - Intronic
920798499 1:209163756-209163778 CAGAAACAGCAAAAGTGGTGGGG - Intergenic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
922897303 1:229110314-229110336 CTATAACTGCAGAAGCAGTGAGG - Intergenic
923199731 1:231699662-231699684 TAGTAAGAGCAGAAGAAGGGAGG - Intronic
1063275936 10:4568036-4568058 CTATAACAGCAGCAGTAGAGGGG + Intergenic
1063470692 10:6282508-6282530 CCGTAGCAGCAGATGTAGTGAGG + Intergenic
1063894798 10:10668567-10668589 GAGTAAAAACAGAAGTAGTTGGG - Intergenic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1067118429 10:43453607-43453629 CAGTAACATCTGTAGTTGTGTGG - Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1070920054 10:80178903-80178925 CAGTTACATCAGAATTACTGGGG - Intronic
1071990354 10:91095385-91095407 AAGTCACAGCAGAAGATGTGAGG + Intergenic
1073860358 10:107731911-107731933 CAGTAACAGCAACAGGGGTGGGG + Intergenic
1074727864 10:116332312-116332334 CAGTAAAAGCAAAAGTAGAAAGG - Intronic
1075263407 10:120981461-120981483 CAGATACCGCAGCAGTAGTGTGG + Intergenic
1082887943 11:58108333-58108355 CAGTAACAGAAGAATAAGTAAGG + Intronic
1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG + Intronic
1085376489 11:76067211-76067233 AAGTAACAGTAAAAGTAGTATGG - Intronic
1086141238 11:83502865-83502887 GAGTAACTTCAGAAGTACTGGGG - Intronic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG + Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1088478913 11:110273769-110273791 CAGAAACAGCAAATGAAGTGTGG - Intronic
1091427248 12:401758-401780 AAGTAACTGCGGAAGCAGTGCGG + Intronic
1092836665 12:12496023-12496045 CAGTAACAGCTGAAGTGATATGG + Intronic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094756971 12:33482338-33482360 CAGGAAGAGCAGAAATAGGGAGG + Intergenic
1095879224 12:47114602-47114624 AAGCAGTAGCAGAAGTAGTGGGG - Intronic
1096028146 12:48386230-48386252 CAGGAACAGCACAAAGAGTGGGG + Intergenic
1096309253 12:50505482-50505504 CAGGAAGCGCAGAAGCAGTGTGG - Intronic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1098064917 12:66603579-66603601 CAGCAACTGCACAGGTAGTGAGG + Intronic
1098586656 12:72162421-72162443 CAGTCACATCAGAATTAGTATGG + Intronic
1099385892 12:82012720-82012742 GAGTAACAGAAGAATTAGAGAGG + Intergenic
1100080685 12:90846442-90846464 GAGAAACAACAGAAGTTGTGGGG - Intergenic
1101006638 12:100407368-100407390 GAGAAACAGCAGAGGTACTGGGG - Intronic
1101044829 12:100794426-100794448 CATTAACAGCAGCAGTGGAGAGG + Intronic
1102499499 12:113341705-113341727 CATTGTGAGCAGAAGTAGTGTGG + Intronic
1105268308 13:18843804-18843826 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1108286757 13:48916335-48916357 AAGTGACAGCAGAGGTAATGGGG + Intergenic
1109074932 13:57822694-57822716 CAGTTACAGAAGAATGAGTGTGG + Intergenic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109327600 13:60887616-60887638 CAGGTAATGCAGAAGTAGTGGGG + Intergenic
1109928432 13:69180084-69180106 CAGGAAAAGCAGAAATCGTGGGG - Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1111833766 13:93361758-93361780 CAGGAACAGCAGTAGTGGTTAGG + Intronic
1112731161 13:102364414-102364436 CAGTAACTCCAACAGTAGTGGGG + Intronic
1114675639 14:24438522-24438544 CAGTAACAGCAGAGTTGGTCTGG - Exonic
1114835444 14:26198037-26198059 CAGGAAAAGCAGACATAGTGAGG + Intergenic
1117175518 14:53142347-53142369 CAGTTAAACCAGCAGTAGTGGGG - Intronic
1117707998 14:58493140-58493162 CAGTTACAGCAGAAATAGAGAGG + Intronic
1118069864 14:62234477-62234499 CAATAATAGGAGAACTAGTGGGG - Intergenic
1118125117 14:62893260-62893282 GAGTAACTGCAGATGTGGTGGGG + Intronic
1122157299 14:99757394-99757416 CAGTGACAGCACAGGTTGTGTGG + Intronic
1202831004 14_GL000009v2_random:30190-30212 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1126393427 15:48184548-48184570 CATTAACATCAGATGTACTGGGG + Intergenic
1127440554 15:59002739-59002761 CAATGACATCAGAAGTAGTCAGG - Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1128079360 15:64847004-64847026 TACTAACAGCAGAAGTTGTAAGG - Intronic
1130197092 15:81790005-81790027 AAATGGCAGCAGAAGTAGTGGGG + Intergenic
1130351090 15:83092374-83092396 GAGAAACAGCAGAATTAGTAAGG + Intergenic
1131618442 15:94041653-94041675 CAGAAAGAGCAGAAATATTGAGG + Intergenic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142905688 17:3040202-3040224 CAGTAACAGCAGAGGTGGATGGG + Intergenic
1145276156 17:21432249-21432271 CAGCAACAGATGAAGGAGTGGGG - Intergenic
1145314000 17:21718163-21718185 CAGCAACAGATGAAGGAGTGCGG - Intergenic
1145712448 17:26990140-26990162 CAGCAACAGATGAAGGAGTGAGG - Intergenic
1145971993 17:28961578-28961600 CAGGAACGGCAGTGGTAGTGAGG - Intronic
1146672404 17:34750555-34750577 CAGCAATAGCAGTAGTAGTAGGG - Intergenic
1146677355 17:34782627-34782649 CACTAACAGCAGTAGGGGTGGGG + Intergenic
1150718934 17:67597916-67597938 CAGTGACAGTAGAAATAGAGAGG + Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1154419711 18:14216230-14216252 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1155064545 18:22257169-22257191 GAGTAACAGCAGCAGAAGAGTGG - Intergenic
1155615356 18:27715725-27715747 CTGTAACATCAGAAGTAGGGAGG - Intergenic
1160083097 18:75749007-75749029 CAGTAACAGCACAAATATGGTGG - Intergenic
1160111940 18:76041346-76041368 CAGTAAGAGCAGAATTAATATGG + Intergenic
1160188101 18:76691463-76691485 CTGTAACACCAGCAGTCGTGAGG + Intergenic
1163098409 19:15078143-15078165 CAGTAAAGACAGAAGTAGCGGGG - Intergenic
1164326317 19:24195536-24195558 CAGTAAGAGCAGAAGTCATAAGG - Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165896149 19:39142501-39142523 CAGATCCAGCAGAAGTAGGGTGG + Intronic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1168447243 19:56430703-56430725 CAGAAACAGCAACAGTAGTCAGG + Intronic
925694677 2:6563418-6563440 CAGTATCAGCAGCAGTGCTGGGG - Intergenic
927826650 2:26313999-26314021 CAGAAACAGAGGAAGCAGTGGGG + Intronic
929696363 2:44119624-44119646 CAATAACAGCAGAAGTGTTCTGG + Intergenic
930794388 2:55372677-55372699 TGGTAACAGCAGAAGAAATGGGG + Intronic
933892186 2:86782091-86782113 CATCAACAGCAGAAGTGGGGTGG + Intergenic
934497517 2:94821034-94821056 CTGTAGCAGCAGAAATACTGTGG + Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
942982911 2:182103921-182103943 CAGTAACAGGAGAATCACTGAGG + Intronic
943172395 2:184419296-184419318 GAGAAACATCAGAAGCAGTGGGG + Intergenic
943511230 2:188830233-188830255 CAGCCACAGCAGGAGTGGTGAGG - Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
1168969930 20:1924069-1924091 CAGTAACAGAAGAAGCAGCCAGG + Intronic
1170586081 20:17735152-17735174 CAACAATTGCAGAAGTAGTGGGG + Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1175241436 20:57552421-57552443 CAGTAACAGCATCAGAAGTAAGG - Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176610192 21:8875029-8875051 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1176853584 21:13943067-13943089 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1177359045 21:20045500-20045522 CAGAAGTGGCAGAAGTAGTGTGG - Intergenic
1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG + Intronic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1180606363 22:17061840-17061862 CAGTTACAGCAGAATGTGTGGGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181817198 22:25447517-25447539 GAGAAAAAGCAGCAGTAGTGTGG - Intergenic
1182534094 22:30987147-30987169 CAGAAACAGCAGAATTAGGCCGG - Intergenic
951117943 3:18887165-18887187 CAGTCAAAGCAGAAGTTGGGGGG - Intergenic
955136455 3:56223579-56223601 AAGTGTCAGCAGAAATAGTGTGG - Intronic
955522314 3:59786812-59786834 CAGGAACAGCTGGAGTATTGAGG - Intronic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956814597 3:72896546-72896568 CATTAAAAGCTGAAGGAGTGTGG + Intronic
957230645 3:77509921-77509943 CAGCATAAGCAGAAGTAGTTGGG + Intronic
958513960 3:95088439-95088461 CATTAACTGCAGAAGCAGTGTGG - Intergenic
959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG + Intergenic
960529115 3:118743373-118743395 CAGTAATAGGAGAGGTAATGAGG - Intergenic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
966402862 3:179564235-179564257 CAGTAACAACAGCAATAGTCTGG - Intronic
967956462 3:194881116-194881138 CATTTACTGCAGCAGTAGTGGGG - Intergenic
968332318 3:197881560-197881582 CAGTAGCAGGAGAAGTATTAGGG + Intronic
968351718 3:198061794-198061816 CTGTAACAGCAGAAATACTGTGG + Intergenic
1202736873 3_GL000221v1_random:9816-9838 CTGTAGCAGCAGAAATACTGTGG - Intergenic
969091128 4:4694732-4694754 CAGTCACAGGAGAGGTAATGAGG - Intergenic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG + Intergenic
970098247 4:12489355-12489377 CAGTAACAGCATAAGCATGGAGG - Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
973155208 4:46943269-46943291 CAGAAACAGCTGAAGTTTTGTGG - Intronic
974386931 4:61213108-61213130 CAACAACAACAGAAGTAATGGGG + Intronic
974479877 4:62429519-62429541 CAATAACAGCAGCATTAGTAGGG + Intergenic
975737493 4:77395404-77395426 GAGTAAGAGCAGAAGTATTTTGG + Intronic
976339818 4:83934620-83934642 GAGTTACAGCAGAAGTTGTCAGG + Intergenic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
977447529 4:97149624-97149646 CAGAAACAGAAACAGTAGTGAGG - Intergenic
977814351 4:101397115-101397137 CAGTAACAGCAGCAGTGCTCAGG - Intergenic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
979055447 4:115987492-115987514 CAGGAACAGAACCAGTAGTGAGG + Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981018210 4:139997454-139997476 CAGTAACAGCACAAAGAGGGTGG - Intronic
981582549 4:146264654-146264676 CAGTTGCAGCAGGAGTTGTGAGG - Intronic
981852663 4:149249545-149249567 TAGTGACAGCAGAACTAGAGAGG - Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986844650 5:11738327-11738349 CAATAACAGCAAAAGCAGTTAGG + Intronic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988635036 5:32974012-32974034 CAGTAACAGGAGCAGTGGTTTGG - Intergenic
989948500 5:50268930-50268952 CAGTAACAGAAGAAGAAGAAAGG + Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
993250302 5:85513109-85513131 GAGCATCAGCTGAAGTAGTGTGG + Intergenic
994998937 5:107102677-107102699 CAGTTCCAGCAGAAGTATTGGGG - Intergenic
996694261 5:126376528-126376550 TTGTAACAGCAGGAGAAGTGGGG - Intronic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG + Intergenic
1001901440 5:175433818-175433840 CTGTTTCAGCAGAATTAGTGTGG + Intergenic
1003402685 6:5803949-5803971 CAGGAACAGTAGAAGTAGGAAGG + Intergenic
1003439558 6:6126648-6126670 CAGTAACAGCCGACTTAGTGGGG + Intergenic
1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG + Intergenic
1009516909 6:64631474-64631496 CAGTATCAGCAACAATAGTGAGG - Intronic
1012922709 6:105235608-105235630 AAGCATCAGCTGAAGTAGTGTGG - Intergenic
1013740896 6:113283428-113283450 AAGTAACAACAGATGTTGTGAGG + Intergenic
1014279846 6:119429622-119429644 AAGAAGCAGCAGAAGTCGTGAGG + Intergenic
1016865077 6:148758384-148758406 CAGGAACAAAAAAAGTAGTGTGG - Intronic
1017894471 6:158667384-158667406 CATTAACAGGAGAAGTCGGGAGG + Intronic
1018220479 6:161573119-161573141 GAGTCACAGGAGAAGTTGTGGGG + Intronic
1019886147 7:3907718-3907740 CCGCAACAGCAGAGGTGGTGAGG + Intronic
1020725663 7:11810547-11810569 CAGTAACAGCAGCATTGGGGTGG - Intronic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1022717300 7:32910180-32910202 CAATAGCAGTACAAGTAGTGTGG + Intergenic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1023786251 7:43711107-43711129 CAGTGACAGCAGAAATCTTGTGG + Intronic
1023846324 7:44122847-44122869 CAATAACAGTTGAAGTACTGGGG - Intronic
1024879491 7:54069512-54069534 TGGTAACAGAAGAAGTAATGTGG - Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1028325166 7:89514942-89514964 CAGTCACAGCAAAAGTAGCCTGG + Intergenic
1028451450 7:90989395-90989417 GAGTAACTGCTGAAGTAGTATGG - Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033287244 7:140051999-140052021 CAGTCACAGCAGAAGTGATCAGG - Intronic
1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG + Intergenic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1041871900 8:62644207-62644229 TAGTAGCAGCAGGAGCAGTGAGG - Intronic
1042398779 8:68321558-68321580 CAGTAAAAGAAGAATGAGTGTGG + Intronic
1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG + Intergenic
1043111905 8:76196091-76196113 TAGTAAAAGCAGAATTAGAGAGG + Intergenic
1044560989 8:93612012-93612034 CAGTAACACAACAAGTAGTAAGG - Intergenic
1045705479 8:104917522-104917544 CAGCAACAGCACAAGTGGGGAGG + Intronic
1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG + Intronic
1048513174 8:135080621-135080643 CAGTGTCAGCAGAAGGGGTGGGG - Intergenic
1051472938 9:17470015-17470037 TAGTAATAGCAGTAGTAGTATGG + Intronic
1051978637 9:22985680-22985702 CAGTAGGAGCACAAGTAATGAGG + Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053659628 9:40259437-40259459 CTGTAGCAGCAGAAATACTGTGG - Intronic
1053909999 9:42888789-42888811 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054360640 9:64112188-64112210 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054371756 9:64405736-64405758 CTGTAGCAGCAGAAATACTGTGG - Intronic
1054524970 9:66116779-66116801 CTGTAGCAGCAGAAATACTGTGG + Intronic
1054679375 9:67895453-67895475 CTGTAGCAGCAGAAATACTGTGG - Intronic
1055203584 9:73698074-73698096 TAGTAGCAGAAGAAATAGTGAGG - Intergenic
1055459062 9:76499746-76499768 TAATAACAGCAGAAACAGTGAGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG + Intergenic
1203705598 Un_KI270742v1:40260-40282 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG + Intergenic
1189207640 X:39255680-39255702 CAGTAACAGCAGAAGCTGCCAGG + Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1190223485 X:48528308-48528330 AAGTAAAACCAGAAGTAGAGAGG - Exonic
1190233418 X:48599177-48599199 CAGGAACAGCAGAACTCGTGAGG + Intronic
1193011752 X:76683455-76683477 CAGTAACATGAGTAGTACTGGGG - Intergenic
1193760785 X:85462859-85462881 AGGAAACATCAGAAGTAGTGTGG + Intergenic
1194422551 X:93695006-93695028 CAGTAGCACCAAGAGTAGTGAGG - Intronic
1196508517 X:116477397-116477419 GAGAAACTGCAGAAGTTGTGAGG - Intergenic
1196787529 X:119434020-119434042 TAGTAACAGTTGTAGTAGTGTGG + Intronic
1198581386 X:138068636-138068658 CAATAACAGCAGAAAGAATGGGG - Intergenic