ID: 1060559709

View in Genome Browser
Species Human (GRCh38)
Location 9:124532993-124533015
Sequence GGTCTTGGGGCTTAAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060559701_1060559709 11 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559709 9:124532993-124533015 GGTCTTGGGGCTTAAGGGACTGG No data
1060559700_1060559709 29 Left 1060559700 9:124532941-124532963 CCAAGGAAGGAAAAGTTTCCTCA 0: 1
1: 0
2: 1
3: 27
4: 345
Right 1060559709 9:124532993-124533015 GGTCTTGGGGCTTAAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060559709 Original CRISPR GGTCTTGGGGCTTAAGGGAC TGG Intronic
No off target data available for this crispr