ID: 1060559711 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:124533008-124533030 |
| Sequence | GGGACTGGCTACAGTGAGAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060559708_1060559711 | -4 | Left | 1060559708 | 9:124532989-124533011 | CCTTGGTCTTGGGGCTTAAGGGA | 0: 1 1: 0 2: 0 3: 11 4: 165 |
||
| Right | 1060559711 | 9:124533008-124533030 | GGGACTGGCTACAGTGAGATGGG | No data | ||||
| 1060559701_1060559711 | 26 | Left | 1060559701 | 9:124532959-124532981 | CCTCACTACTTCTGCTGTTACTG | 0: 1 1: 0 2: 3 3: 19 4: 220 |
||
| Right | 1060559711 | 9:124533008-124533030 | GGGACTGGCTACAGTGAGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060559711 | Original CRISPR | GGGACTGGCTACAGTGAGAT GGG | Intronic | ||
| No off target data available for this crispr | |||||