ID: 1060559711

View in Genome Browser
Species Human (GRCh38)
Location 9:124533008-124533030
Sequence GGGACTGGCTACAGTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060559708_1060559711 -4 Left 1060559708 9:124532989-124533011 CCTTGGTCTTGGGGCTTAAGGGA 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1060559711 9:124533008-124533030 GGGACTGGCTACAGTGAGATGGG No data
1060559701_1060559711 26 Left 1060559701 9:124532959-124532981 CCTCACTACTTCTGCTGTTACTG 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1060559711 9:124533008-124533030 GGGACTGGCTACAGTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060559711 Original CRISPR GGGACTGGCTACAGTGAGAT GGG Intronic
No off target data available for this crispr