ID: 1060563570

View in Genome Browser
Species Human (GRCh38)
Location 9:124568763-124568785
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060563565_1060563570 14 Left 1060563565 9:124568726-124568748 CCTTATTACTCTTCAAAAGATAG 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr