ID: 1060565427

View in Genome Browser
Species Human (GRCh38)
Location 9:124586829-124586851
Sequence TCATTTTAACAGTGTTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 2, 2: 2, 3: 49, 4: 417}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060565427_1060565429 30 Left 1060565427 9:124586829-124586851 CCTGGTGAACACTGTTAAAATGA 0: 1
1: 2
2: 2
3: 49
4: 417
Right 1060565429 9:124586882-124586904 TCATTGATAAAGCAGCAGCAGGG No data
1060565427_1060565428 29 Left 1060565427 9:124586829-124586851 CCTGGTGAACACTGTTAAAATGA 0: 1
1: 2
2: 2
3: 49
4: 417
Right 1060565428 9:124586881-124586903 TTCATTGATAAAGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060565427 Original CRISPR TCATTTTAACAGTGTTCACC AGG (reversed) Intronic
900538544 1:3191172-3191194 TCACATTAACATTTTTCACCTGG - Intronic
901914302 1:12486378-12486400 TCATTTGAAGAGAGTTCTCCTGG + Intronic
902523636 1:17038690-17038712 TGATTTTCACAGTCTTCATCTGG + Intronic
903982289 1:27197808-27197830 TCATTTTAAAAGTCTCCTCCTGG - Intergenic
904169333 1:28580628-28580650 TCATCTTAAGAGTCTTCATCTGG + Intergenic
904790868 1:33019791-33019813 TCATTTTAACAGTGGCTAACTGG + Intronic
905353705 1:37366048-37366070 TCACTTTAACAGTAAACACCTGG - Intergenic
905464841 1:38145372-38145394 TCACTTTAACAGTAGACACCTGG - Intergenic
906930919 1:50168354-50168376 TCACTTTAACAGTAGACACCTGG + Intronic
907726120 1:57022142-57022164 TCATTTCAAAAATGCTCACCAGG - Intronic
908569525 1:65394117-65394139 GCATTTTAAGACTGTGCACCTGG + Intronic
909266966 1:73572032-73572054 TCATTTTAACCTTGATCACATGG - Intergenic
909418253 1:75432177-75432199 TCATTTTAGGAAGGTTCACCAGG - Intronic
909571557 1:77117797-77117819 TCATTTTAGTAGTGTTCTTCAGG + Intronic
910222950 1:84907370-84907392 GCATTTTAACAATATTCCCCAGG + Intergenic
910587841 1:88899003-88899025 TCACTTTAACAGTAGACACCTGG - Intergenic
910789955 1:91041115-91041137 TCACTTTAACAGTAGACACCTGG - Intergenic
910948045 1:92615436-92615458 TCACTTTAACAGTAGACACCTGG - Intronic
911109385 1:94166243-94166265 TCACTTTAACAGTAAACACCTGG + Intronic
911722356 1:101205274-101205296 TCATCATCACTGTGTTCACCTGG + Intergenic
911758979 1:101594838-101594860 TCATTTTAACAATGTTTTACTGG + Intergenic
915668032 1:157462382-157462404 TCATTTTAACAGTAGACAACTGG + Intergenic
918732777 1:188019055-188019077 TCAGTTTCACAGTGTTTACATGG + Intergenic
918756088 1:188340530-188340552 TCACTTTAACAGTAGCCACCCGG + Intergenic
918814744 1:189168504-189168526 TCACTTTAACAGTAGACACCTGG - Intergenic
918918570 1:190674552-190674574 TCACTTTAACAGTAGACACCTGG + Intergenic
919125016 1:193382827-193382849 TCGTTTTAACAGTAGACACCTGG + Intergenic
919221395 1:194633891-194633913 TGATGTTAACATTGATCACCTGG + Intergenic
919241436 1:194921780-194921802 TCACTTTAACAGTAGCCACCTGG - Intergenic
919415396 1:197301925-197301947 CTATTTCGACAGTGTTCACCAGG - Intronic
920241978 1:204559218-204559240 TCATTTAAAAAGTGTTACCCTGG - Intergenic
921210281 1:212890223-212890245 ACATTTTAAAAGTATGCACCTGG - Intronic
923275835 1:232395474-232395496 ATTTTGTAACAGTGTTCACCAGG + Intergenic
924847553 1:247788260-247788282 TCACTTTAACAGTAGACACCTGG + Intergenic
1066169360 10:32825828-32825850 TCACTTTAACAGTAGACACCTGG - Intronic
1066543353 10:36473737-36473759 TCACTTTAACAGTAGACACCTGG - Intergenic
1068044099 10:51863317-51863339 CTATCTTGACAGTGTTCACCTGG + Intronic
1068225711 10:54104354-54104376 TCACTTTAACAGGGGACACCTGG + Intronic
1068824021 10:61412629-61412651 TCAGTTGAGCAGTGTTCATCTGG - Intronic
1070446220 10:76506235-76506257 TCATTTTAAAAATAATCACCAGG - Intronic
1070596349 10:77835395-77835417 TCCTTTCAGCAGTATTCACCGGG - Intronic
1071267468 10:83976722-83976744 TCACTTTAACAGTAGACACCTGG + Intergenic
1071378026 10:85030688-85030710 TCACTTTAACAGTAGACACCTGG - Intergenic
1071674279 10:87639939-87639961 TTATTTTAACAGTAGACACCTGG + Intergenic
1073556958 10:104463176-104463198 TCATTTTAACAGTAGACATCTGG - Intergenic
1074191755 10:111144178-111144200 TCATTTTTAAAGAGTTTACCAGG + Intergenic
1075833936 10:125436939-125436961 TTATTTTAACAGTGTACAGCGGG + Intergenic
1076927783 10:133501963-133501985 TCACTTTAACAGTAGACACCTGG + Intergenic
1078398770 11:11004955-11004977 TCATTTCAACAATGTTCACCAGG + Intergenic
1078739542 11:14053538-14053560 TCATGTTAAAAATGTTCACAGGG - Intronic
1080158287 11:29139387-29139409 TGATATTAACATTGATCACCTGG + Intergenic
1080372495 11:31667620-31667642 TCATTTTGACAGTGTTCTTCAGG - Intronic
1082999252 11:59276809-59276831 TCACTTTAACAGTAGACACCTGG - Intergenic
1083075229 11:60029908-60029930 TAATTTTAACAGTGTTAATAAGG + Intergenic
1085342241 11:75740218-75740240 TGATTTTAACCTTGATCACCTGG - Intergenic
1086961929 11:92986588-92986610 TCACTTTAACAGTAGACACCTGG + Intergenic
1087650877 11:100866102-100866124 TCATTTCAACAGTATTCACAAGG + Intronic
1088192060 11:107237245-107237267 TCACTTTAACAGTAGACACCTGG + Intergenic
1088407977 11:109501417-109501439 TCACTTTAACAGTAGACACCTGG + Intergenic
1090210028 11:124912515-124912537 TCATTTTAACAGTAGACACCTGG + Intergenic
1090221976 11:125034336-125034358 TCATTTTAACAGTAGACACCTGG + Intronic
1091037138 11:132244473-132244495 TCATTTTAAATGTGTACCCCAGG + Intronic
1091051366 11:132376003-132376025 TCACTTTAACAGTAGACACCTGG - Intergenic
1091308654 11:134557598-134557620 TTGTTTTCAAAGTGTTCACCTGG + Intergenic
1093035880 12:14332294-14332316 TCACTTTAACAGTAGACACCTGG - Intergenic
1093249797 12:16788271-16788293 ATATTTTCCCAGTGTTCACCAGG + Intergenic
1093411190 12:18869290-18869312 TACTTTGAACATTGTTCACCTGG + Intergenic
1094069713 12:26399498-26399520 GCATTTTAACACTGTTCATCAGG - Intronic
1094621403 12:32083978-32084000 TGATTTAAACAAGGTTCACCAGG + Intergenic
1095043970 12:37478450-37478472 TCAGTTTGTCAGTGTTCTCCTGG + Intergenic
1095282268 12:40367822-40367844 TTATTTTAAAAATGTTCACATGG + Exonic
1095603708 12:44043356-44043378 TCACTTTAACAGTAGACACCTGG - Intronic
1096126196 12:49121600-49121622 TCATTTTAACAGTGAACTCAAGG + Intergenic
1097076482 12:56398748-56398770 TCACTTTAACAGTAGACACCTGG - Intergenic
1097490633 12:60265635-60265657 TCATTTTAATAGGGATCAACTGG + Intergenic
1097545521 12:60996167-60996189 TCATTTTTAAAATGTTCACAAGG + Intergenic
1097821813 12:64135255-64135277 TCACTTTAACAGTAGACACCTGG + Intronic
1098749465 12:74276748-74276770 TCATTTTAACAGTAGACACCTGG - Intergenic
1099133918 12:78869248-78869270 TCATTTTAAGAGTGTTCTTGAGG + Intronic
1099365571 12:81762712-81762734 TCACTTTAACAGTAGACACCTGG - Intergenic
1099375280 12:81891224-81891246 TCACTTTAACAGTAGACACCTGG - Intergenic
1099526020 12:83720430-83720452 TCACTTTAACAGTAGACACCTGG - Intergenic
1099577721 12:84402699-84402721 TCACTTTAACAGTAGACACCTGG - Intergenic
1099735401 12:86562315-86562337 TCACTTTAACAGTAGACACCTGG - Intronic
1099859767 12:88211352-88211374 TCACTTTAACAGTGGACACCTGG + Intergenic
1100241548 12:92714437-92714459 TCACTTTAACAGTAGGCACCTGG + Intergenic
1100686076 12:96986953-96986975 TCAATTTAAAAGTGTTCAAATGG - Intergenic
1101535055 12:105608854-105608876 TCACTTTAACAGTAGACACCTGG + Intergenic
1103035177 12:117650984-117651006 TCACTTTAACAGTAAACACCTGG - Intronic
1103511026 12:121474318-121474340 GGGTTTTCACAGTGTTCACCAGG - Intronic
1107424786 13:40281942-40281964 TCATTTTAACAGTAGACACCTGG + Intergenic
1107490100 13:40873608-40873630 TCACTTTAACAGTAGACACCTGG - Intergenic
1107649448 13:42529407-42529429 TCATGTTAACCTTGATCACCTGG + Intergenic
1107983949 13:45758711-45758733 TCACTTTAACAGTAGGCACCTGG + Intergenic
1109515929 13:63442580-63442602 TCACTTTAACAGTAGACACCTGG - Intergenic
1109951381 13:69504906-69504928 TCACTTTAACAGTAGACACCTGG + Intergenic
1111016552 13:82388574-82388596 TCACTTTAACAGTAGACACCTGG + Intergenic
1111309639 13:86467105-86467127 TAATTTTAGAAGTGTTCATCAGG - Intergenic
1111440730 13:88280453-88280475 TCACTTTAACAGTAGACACCTGG - Intergenic
1111560670 13:89940888-89940910 TCATTTGTACAGTGTTAACTTGG - Intergenic
1111576113 13:90155509-90155531 TCACTTTAACAGTAGACACCTGG + Intergenic
1112231509 13:97592901-97592923 TCACTTTAACAGTAGACACCTGG + Intergenic
1112250302 13:97772962-97772984 TCACTTTAACAGTAGACACCTGG + Intergenic
1112607938 13:100926411-100926433 TCAATTTAAAAGTGTTCACAGGG + Intergenic
1112682502 13:101783174-101783196 TCTTTTTAAAAGTGTTGGCCGGG + Intronic
1113003249 13:105668380-105668402 TGATGTTAACACTGATCACCTGG - Intergenic
1113320081 13:109224424-109224446 TCATTTTATCAGTAGACACCTGG + Intergenic
1114205537 14:20568361-20568383 TCACTTTAACAGTAGACACCTGG - Intergenic
1114758620 14:25286472-25286494 TCACTTTAACAGTAGACACCTGG + Intergenic
1115302684 14:31902164-31902186 TCATTCCAACAGTGTTTATCTGG + Intergenic
1116158754 14:41239417-41239439 TCACTTTAACAGTAGACACCTGG + Intergenic
1116387849 14:44354459-44354481 TTGTTTTAACAGTGTTAACCAGG + Intergenic
1116414712 14:44666564-44666586 TCAGTTTAACAGTAGACACCTGG - Intergenic
1117597128 14:57334590-57334612 TCACTTTAACAGTAGACACCTGG + Intergenic
1118075784 14:62297222-62297244 ACATTTTAACAGGATTCTCCAGG + Intergenic
1118383264 14:65235013-65235035 TCATTCCAAGAGTGTTCTCCTGG - Intergenic
1118725960 14:68629106-68629128 TCATTTTAGCAGTGGCCCCCAGG + Intronic
1118741617 14:68743639-68743661 TCATTTTCCCAGTGAGCACCAGG - Intergenic
1120082399 14:80230287-80230309 TCACTTTAACAGTAGACACCTGG + Intronic
1120556369 14:85933174-85933196 TCACTTTAACAGTGGACACCTGG + Intergenic
1120562440 14:86012396-86012418 TCCTTCTAACAGTGTTCTCAAGG + Intergenic
1121370999 14:93358540-93358562 TCACTTTAACAGTAGACACCTGG - Intronic
1121846215 14:97174441-97174463 TCATTTTAACAATGTTTATGGGG - Intergenic
1202942510 14_KI270725v1_random:166083-166105 TCAGTTTGTCAGTGTTCTCCTGG + Intergenic
1124904931 15:33859231-33859253 TAATTTTAAGAGTGTTAGCCTGG - Intronic
1125378554 15:39060692-39060714 TCATTCTAACGCTGTCCACCTGG - Intergenic
1125445634 15:39752445-39752467 TAATGTTAACTCTGTTCACCTGG - Intronic
1126290909 15:47077412-47077434 TCAGTTTGTCAGTGTTCTCCTGG - Intergenic
1128034982 15:64516910-64516932 TGATTTTAAAAATTTTCACCAGG + Intronic
1128240864 15:66100165-66100187 TCACTCTACCAGTGTTTACCGGG + Intronic
1128699043 15:69790578-69790600 GCATTTCCACAGTGGTCACCTGG + Intergenic
1130608427 15:85338524-85338546 GCATTTTTAAAGTGTTGACCAGG - Intergenic
1130722095 15:86398214-86398236 CCATTTCAACAGAGCTCACCAGG - Intronic
1131036474 15:89225804-89225826 TAATTTTAATGGAGTTCACCAGG + Intergenic
1131401746 15:92130940-92130962 TCCTTTTCACAGTGATCCCCTGG + Intronic
1133291221 16:4722615-4722637 TCAATTTAAAAATGTTCAACTGG + Intronic
1135662671 16:24310265-24310287 TTATTTAAACAGTGTTAAGCTGG + Intronic
1136370441 16:29832766-29832788 TCATTTTAAATATGTTCAGCCGG + Intronic
1137259200 16:46809307-46809329 TCATTTTAACAGGCTTCTTCAGG + Intronic
1137310978 16:47258135-47258157 TGATGTTAACCTTGTTCACCTGG - Intronic
1137463759 16:48689562-48689584 TTATTTTTACAGTGTTCAGCAGG - Intergenic
1137940465 16:52678601-52678623 TCACTTTAACAGTGTCCATCTGG + Intergenic
1138908719 16:61370033-61370055 GCTTTTTAACATTGTTCACCTGG + Intergenic
1142976693 17:3648865-3648887 TGATTTCAAAAGTGATCACCAGG - Exonic
1143858542 17:9871055-9871077 GCATTTTAACAGTTTTCTGCTGG - Intronic
1144289095 17:13808286-13808308 TAATATTCACAGTGTTCAACTGG + Intergenic
1144547424 17:16210583-16210605 TCAGTGTTACAGTGATCACCAGG - Intronic
1146690341 17:34870492-34870514 TGATTTTAACAGGGTTGGCCGGG + Intergenic
1146758454 17:35454414-35454436 TCACTTTAACAGTAGACACCTGG - Intergenic
1151037991 17:70822962-70822984 TCACTTTAACAGTAGACACCTGG + Intergenic
1151201229 17:72469447-72469469 TTATTTAAACAGTGGTGACCGGG - Intergenic
1153131644 18:1860434-1860456 TCACTTTAACAGTAGACACCTGG + Intergenic
1153218085 18:2838352-2838374 TCACTTTAACAGTAGACACCTGG + Intergenic
1153444893 18:5160263-5160285 TCATTTTAAAAGTTTCAACCTGG + Intronic
1154068100 18:11128388-11128410 TCACTTTAACAGTAGACACCTGG - Intronic
1154505826 18:15040119-15040141 TCACTTTAACAGTAGACACCTGG - Intergenic
1155525233 18:26709440-26709462 TCTTTTTCAGAGTTTTCACCTGG + Intergenic
1155573476 18:27220460-27220482 TCACTTTAACAGTAGACACCTGG - Intergenic
1156192405 18:34734458-34734480 TCACTTTAACAGTAGTCACCTGG + Intronic
1156303502 18:35856016-35856038 TCACTTTAACAGTAGACACCTGG - Intergenic
1156990660 18:43403451-43403473 TCACTTTAACAGTAGACACCTGG + Intergenic
1156998240 18:43494969-43494991 TCACTTTAACAGTAGACACCTGG - Intergenic
1164117678 19:22237858-22237880 TCACTTTAACAGTAGACACCTGG + Intergenic
1167864706 19:52315138-52315160 TCATTTTTACAATGTTGGCCAGG + Intronic
1168539734 19:57200202-57200224 TCACTTTAACAGTAGACACCTGG - Intronic
925499769 2:4489661-4489683 TCACTTTAACAGTAGACACCTGG + Intergenic
926810769 2:16753426-16753448 TCACTTTAACAGTAGACACCTGG + Intergenic
926825961 2:16905102-16905124 TCACTTTAACAGTAGACACCTGG + Intergenic
927224345 2:20748666-20748688 TGAATTAAACAGTGTTCTCCAGG + Intronic
928034580 2:27810035-27810057 TCATTTTCACAGTGTAGACCTGG - Intronic
928751370 2:34474343-34474365 TTAATTTAACAGTGATCACTGGG - Intergenic
929870717 2:45756952-45756974 TTATTTAAAGAGTGTTCAGCTGG + Intronic
930536964 2:52655011-52655033 TCACTTTAACAGTAGACACCTGG + Intergenic
930690207 2:54354811-54354833 TCTTTTTTATAGTATTCACCAGG + Intronic
930909783 2:56618084-56618106 TCACTTTAACAGTAGACACCTGG - Intergenic
931761518 2:65421461-65421483 TCATTTTACCAGATTTCCCCAGG + Intronic
933576065 2:84069683-84069705 TCATTTTCCCAGTGTTAAACAGG - Intergenic
935376287 2:102400921-102400943 TCATCTTAATAGTGTTCACTTGG - Intergenic
935425468 2:102914075-102914097 TCACTTTAACAGTAGACACCTGG + Intergenic
935564677 2:104592982-104593004 TCACTTTAACAGTAGACACCTGG + Intergenic
936640915 2:114312280-114312302 TCACTTTAACAGTAGACACCTGG - Intergenic
937335642 2:121060626-121060648 TCATTTTAAAAATGTTCCCTTGG - Intergenic
937785561 2:125890411-125890433 TCACTTTAACAGTTGACACCTGG + Intergenic
937799964 2:126071997-126072019 TCACTTTAACAGTAGACACCTGG - Intergenic
937852928 2:126651443-126651465 TCATTCTAACAGTAGACACCTGG + Intergenic
938892558 2:135720284-135720306 GCATCTTCACTGTGTTCACCCGG + Intronic
939086146 2:137720954-137720976 TCACTTTAACAGTAGACACCTGG - Intergenic
939205839 2:139102593-139102615 TTCTTTTAACAGTGTTCTCAAGG + Intergenic
939213453 2:139209160-139209182 TCACTTTAACAGTAGACACCTGG - Intergenic
939471298 2:142624532-142624554 CCATTTTGAGAGTTTTCACCTGG - Intergenic
939501023 2:142984679-142984701 TCATTTTTACAGTTTTCACAAGG + Intronic
939677753 2:145093564-145093586 TTACTTTAACAGTGGACACCCGG + Intergenic
939772460 2:146338345-146338367 TCATTTTCACCATTTTCACCCGG - Intergenic
939805877 2:146775725-146775747 TCACTTTAACAGTAGACACCTGG - Intergenic
940171694 2:150835469-150835491 TCACTTTAACAGTAGACACCTGG + Intergenic
940634481 2:156281222-156281244 TCATTCTTACATTGTTCAACTGG - Intergenic
943006192 2:182390699-182390721 TCACTTTAACAGTAGACACCTGG - Intronic
943318214 2:186414411-186414433 TCACTTTAACAGTAGACACCTGG + Intergenic
943384383 2:187183605-187183627 TCACTTTAACAGTAGACACCTGG + Intergenic
943386021 2:187204388-187204410 TCACTTTAACAGTAAACACCTGG + Intergenic
943429451 2:187779974-187779996 TCATTTAAATAGTCTTCATCTGG - Intergenic
944005380 2:194898112-194898134 ACATTTTAAATGTGTTCAACAGG - Intergenic
945277784 2:208005612-208005634 TCATGTTAACCTTGATCACCTGG + Intronic
945991101 2:216396026-216396048 TCATTTTAAATATGTTGACCAGG + Intergenic
946528226 2:220542710-220542732 TCAATTTAACAGTAGACACCTGG + Intergenic
946790555 2:223297002-223297024 TCACTTTAACAGTAGACACCTGG - Intergenic
946964904 2:225027345-225027367 TCATTATTACAGTGGTCATCGGG - Intronic
1171538495 20:25922030-25922052 TCAGTTTGTCAGTGTTCTCCTGG + Intergenic
1171841441 20:30217320-30217342 TCAGTTTGTCAGTGTTCTCCTGG + Intergenic
1174879712 20:54265899-54265921 TCATTTTATAAGGGTTAACCTGG - Intergenic
1175041952 20:56060626-56060648 TCATTTTGACAGAGGTCATCTGG + Intergenic
1175409588 20:58757813-58757835 TCACTTTAACAGTAGACACCTGG + Intergenic
1176792035 21:13328907-13328929 TCACTTTAACAGTAGACACCTGG + Intergenic
1176997785 21:15577476-15577498 TCACTTTAACAGTAGACACCTGG - Intergenic
1177003002 21:15636290-15636312 TCACTTTAACAGTAGGCACCTGG + Intergenic
1177505979 21:22017262-22017284 TCACTTTAACAGTAGACACCTGG + Intergenic
1177892111 21:26818516-26818538 TCCCTGTAAAAGTGTTCACCCGG - Intergenic
1177912817 21:27053466-27053488 TCATTTTAACAGTAGACACCTGG - Intergenic
1177991432 21:28039913-28039935 TCACTTTAACAGTAGACACCTGG + Intergenic
1178012267 21:28302164-28302186 TCACTTTAACAGTAGACACCTGG - Intergenic
1178061112 21:28853899-28853921 TCACTTTAACAGTAGACACCTGG + Intergenic
1178469579 21:32880291-32880313 TCATTTTCTCAGTGGTCACAGGG + Intergenic
1178764202 21:35433689-35433711 TCACTTTAACAGTAGACACCTGG + Intronic
1179146080 21:38769019-38769041 TAATTTTAACCTTGTTCTCCTGG - Intergenic
1181326030 22:22046831-22046853 TCATTTTAACATTGTGCACTGGG + Intergenic
949445243 3:4128261-4128283 TCACTTTAACAGTAGACACCTGG - Intronic
949638415 3:6009774-6009796 TCACTTTAACAGTAGACACCTGG - Intergenic
951082150 3:18465464-18465486 TCATTTTAACTGGGGTTACCAGG + Intergenic
951122223 3:18942836-18942858 TCACTTTAACAGTAGACACCTGG - Intergenic
951291016 3:20872646-20872668 TCACTTTAACAGTAGACACCTGG - Intergenic
951958351 3:28284297-28284319 TCATCTAAACAGACTTCACCAGG - Intronic
953786098 3:45912452-45912474 TCATTTCAACAGTGTTCTGTTGG - Intronic
954511893 3:51132731-51132753 TCACTTTAACAGTAGACACCTGG - Intronic
954854452 3:53631293-53631315 TCATTTCAACAGTGTTCACCAGG + Intronic
955035210 3:55261341-55261363 TCACTTTAACAGTAGACACCTGG - Intergenic
955872391 3:63452843-63452865 CCATTTTACCAGTATTTACCAGG - Intronic
956783514 3:72623505-72623527 ACATTTCAATAGTGTGCACCTGG + Intergenic
957247906 3:77736083-77736105 TCACTTTAACAGTAGACACCTGG + Intergenic
957897755 3:86445999-86446021 TCATTTTAACAGTAGACACCTGG - Intergenic
958256200 3:91328276-91328298 TCATATTAACTGTAGTCACCAGG + Intergenic
958789215 3:98631330-98631352 TCACTTTAACAGTAGACACCTGG + Intergenic
958845853 3:99262990-99263012 TCACTTTAACAGTAGGCACCTGG + Intergenic
959204150 3:103283533-103283555 TCACTTTAACAGTAGACACCTGG + Intergenic
959377761 3:105605922-105605944 TCACTTTAACAGTAGACACCTGG + Intergenic
959746371 3:109779993-109780015 TCACTTTAACAGTAGACACCTGG + Intergenic
961973413 3:130994610-130994632 TCAGTTTCACAGTGTTCAGGTGG + Intronic
962021635 3:131508363-131508385 TCAACCTAACAGTGTTTACCTGG + Intergenic
962166618 3:133055894-133055916 TCATTAGAACAGTATTTACCAGG + Intronic
963227296 3:142875360-142875382 TCCTGGTAACAGTGTTCACCAGG + Intronic
963356034 3:144209590-144209612 TCACTTTAACAGTACACACCTGG + Intergenic
963432720 3:145230102-145230124 ACATTTTAACAGTAGACACCTGG + Intergenic
963492774 3:146021952-146021974 TGATTTTAAAATTGGTCACCTGG - Intergenic
963566501 3:146937934-146937956 TCATTTTAACAGTAGACACCTGG - Intergenic
963629939 3:147720457-147720479 TCACTTTAACAGTAGACACCTGG - Intergenic
964185770 3:153941044-153941066 TTATTTCAACAATGTTCACAGGG + Intergenic
965299288 3:166989563-166989585 TCACTTTAACAGTACACACCTGG + Intergenic
966044698 3:175533669-175533691 TCACTTTAACAGTGAACACCTGG + Intronic
966445305 3:179995824-179995846 TCACTTTAACAGTAGACACCTGG - Intronic
966742115 3:183243371-183243393 TCATTTTAACAGTAGACACCTGG + Intronic
967505656 3:190249932-190249954 TCACTTTAACAGTAAACACCTGG + Intergenic
968744220 4:2351166-2351188 TCATCTTGACACTGTCCACCCGG - Intronic
968906490 4:3454872-3454894 TCACTTTAACAGTAGACACCTGG - Intergenic
969548430 4:7847891-7847913 TCCTTTCAACAGAGTTCACACGG - Intronic
970585547 4:17511429-17511451 GCATTTAAACAGTTTTTACCAGG + Intronic
971467951 4:26985059-26985081 TCATTTGCACAGTGGTCAGCAGG - Intronic
971979656 4:33735608-33735630 TCACTTTAACAGTGGACACCTGG + Intergenic
972975026 4:44623919-44623941 GCAATTTATCAGTGTTCACCAGG + Intronic
973092637 4:46157570-46157592 TCTTTTTAACAGTAGACACCTGG - Intergenic
973102644 4:46292390-46292412 TCACTTTAACAGTAGACACCTGG - Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
973602223 4:52553151-52553173 TCATTTTAACAGTGTCCTATTGG + Intergenic
974289237 4:59910013-59910035 TCATTTTAACAGTAGACAACTGG - Intergenic
974399067 4:61377646-61377668 TCATTTTAACATTGGTCTTCTGG + Intronic
974573106 4:63681292-63681314 TCATTTTAAAACTTTCCACCAGG + Intergenic
974726726 4:65808712-65808734 TCATTTTAACAGCAGACACCTGG - Intergenic
974934185 4:68394053-68394075 GCATTTTTACAGTGTTGGCCAGG + Intergenic
975900273 4:79143136-79143158 TCATTTCAGCAGTGTTTGCCAGG + Intergenic
976952681 4:90851675-90851697 TTGTTTTAACAATGTTCACAAGG + Intronic
977253899 4:94718982-94719004 TCATTTTAACAATATTAACTCGG - Intergenic
977430393 4:96925484-96925506 TCACTTTAACAGTAGACACCTGG - Intergenic
977538952 4:98291703-98291725 TCATTTTGTCACTGTACACCTGG + Intronic
977702107 4:100032635-100032657 TCATTTTAATAGTAGACACCTGG + Intergenic
977887020 4:102263790-102263812 TCATTTCAGCAATGTTCACCAGG + Intronic
977930754 4:102746260-102746282 TCACTTTAACAGTAGACACCTGG + Intronic
978092958 4:104740043-104740065 TCATGGTAAAAGTGATCACCTGG - Intergenic
978342213 4:107730364-107730386 TCACTTTAACAGTAGGCACCTGG + Intergenic
978899455 4:113929594-113929616 TCACTTTAACAGTAGACACCTGG + Intronic
979075361 4:116263652-116263674 TCATTTTAACAGTAGGCACCTGG - Intergenic
979567648 4:122173522-122173544 TCATTTTAACAGTGTTAGAAGGG - Intronic
980388271 4:132113848-132113870 TCACTTTAACAGTAGACACCTGG + Intergenic
980406262 4:132356569-132356591 TCACTTTAACAGTAGACACCTGG + Intergenic
980601797 4:135036728-135036750 TCACTTTAACAGTAGACACCTGG - Intergenic
980628307 4:135404911-135404933 TCACTTTAACAGTAGACACCTGG - Intergenic
980957403 4:139443643-139443665 TCACTTTAACAGTAGACACCTGG - Intergenic
981462431 4:145029049-145029071 TCACTTTAACAGTAGACACCTGG - Intronic
981712164 4:147720322-147720344 TCATTTTAACTGTGTTCTTCTGG - Intergenic
983184699 4:164688867-164688889 TCACTTTAACAGTAGACACCTGG - Intergenic
983581871 4:169317513-169317535 TCATTTTAACAGTAGACACCTGG - Intergenic
983785321 4:171722283-171722305 TCACTTTAACAGTAGACACCTGG + Intergenic
984061421 4:174992557-174992579 TCACTTTAACAGTAGACACCTGG + Intergenic
984094130 4:175412894-175412916 TCATATTTACAAGGTTCACCAGG - Intergenic
986742620 5:10717355-10717377 TCACTTTAACAGTAGACACCTGG - Intronic
986955900 5:13148890-13148912 TCACTTTAACAGTAGACACCTGG + Intergenic
987152796 5:15058925-15058947 TCACTTTAACAGTAGACACCTGG - Intergenic
987384118 5:17312766-17312788 TCTTTTTCACAGTGCTCACAGGG - Intergenic
987504041 5:18747108-18747130 TCACTTTAACAGTAGACACCTGG - Intergenic
987621459 5:20342163-20342185 TCACTTTAACAGTAGACACCGGG - Intronic
987657475 5:20824392-20824414 TCACTTTAACAGTAGACACCTGG + Intergenic
987885257 5:23805162-23805184 TCCTTTTAACAGTAGACACCTGG - Intergenic
988766068 5:34379554-34379576 TCACTTTAACAGTAGACACCTGG - Intergenic
989045680 5:37270988-37271010 TCACTTTAACAGTAGACACCTGG + Intergenic
989097406 5:37794247-37794269 TCACTTTAACAGTAGACACCTGG - Intergenic
989382435 5:40822552-40822574 TCATTATAACAGTGTTAAGTGGG + Intergenic
989738851 5:44744779-44744801 TCATTTTAACAGTTTTAAACAGG + Intergenic
989797187 5:45490088-45490110 TCTTTTTAACATGTTTCACCTGG - Intronic
990454709 5:55973933-55973955 TCATTTTATCAGTTTTAGCCTGG - Intronic
991632478 5:68670134-68670156 CTATTTTAACAGTATTCACTAGG + Intergenic
992676357 5:79110114-79110136 TCATCTCACCAGTGCTCACCAGG + Intronic
993232255 5:85250289-85250311 TCACTTTAACAGTAGACACCTGG + Intergenic
993319481 5:86455851-86455873 TCACTTTAACAGTAGACACCTGG - Intergenic
993412945 5:87594568-87594590 TCATTTTAACAGTAGACACCTGG + Intergenic
993766991 5:91872400-91872422 TGATTTTAACAGTGCCCTCCAGG - Intergenic
993791415 5:92216157-92216179 TCACTTTAACAGTAGACACCTGG - Intergenic
994291754 5:98034730-98034752 TCACTTTAACAGTAGACACCTGG + Intergenic
994836771 5:104865399-104865421 TCAATTTAACAGTAGACACCTGG - Intergenic
995269918 5:110208221-110208243 TCACTTTAACAGTAGACACCTGG + Intergenic
995279443 5:110316654-110316676 TCACTTTAACAGTAGACACCTGG + Intronic
995428101 5:112046527-112046549 TCACTTTAACAGTAGACACCTGG + Intergenic
995776670 5:115730422-115730444 TCATTTTAACAGTAGACACCTGG + Intergenic
995843684 5:116469649-116469671 TCAATTTAACTGTGTTCAAGAGG + Intronic
995977077 5:118052030-118052052 TCATTTTTACAGTTTTTACTGGG - Intergenic
996165319 5:120215283-120215305 TCACTTTAACAGTAGACACCTGG + Intergenic
996909071 5:128634771-128634793 TCATTTTAACAGTCGACATCTGG + Intronic
996982800 5:129519971-129519993 TCATTTTAACTTTGATCTCCAGG - Intronic
998290709 5:140911345-140911367 TCATTTCAACAGTAGACACCTGG + Intronic
998831960 5:146169335-146169357 TAACTTTAACAGTGTTTACTTGG - Intronic
1000223662 5:159237352-159237374 TCACTTTAACAGTAGACACCTGG + Intergenic
1000416608 5:160991176-160991198 TCACTTTAACAGTAGACACCTGG - Intergenic
1000888931 5:166781431-166781453 ATATTTTCACAGTGTACACCAGG + Intergenic
1003696273 6:8408850-8408872 TCACTTTAACAGTAGACACCTGG + Intergenic
1003758234 6:9147294-9147316 TCACTTTAACAGTAGACACCTGG - Intergenic
1004673812 6:17822415-17822437 TCATGTTAACACTGTGCACCAGG + Intronic
1005298801 6:24451191-24451213 TCACTTTAACAGTGTACAGATGG + Intronic
1007995631 6:46304892-46304914 TCATTTGCACAGTGTTCTACTGG - Intronic
1008399913 6:51052749-51052771 TCACTTTAACAGTAGACACCGGG - Intergenic
1008566140 6:52770417-52770439 TTATTTTAAAAGTATTCGCCAGG - Intergenic
1009187627 6:60592270-60592292 TCATATTAACTGTAGTCACCAGG - Intergenic
1009381215 6:63032377-63032399 TCATTTAAAAAGTGTCCGCCAGG - Intergenic
1010325684 6:74559350-74559372 TCACTTTAACAGTAGACACCTGG + Intergenic
1010572188 6:77490150-77490172 TGCATTTAACAGTGTTCACTAGG + Intergenic
1010818223 6:80385354-80385376 TCACTTTAACAGTAGACACCTGG - Intergenic
1010938525 6:81888458-81888480 TCACTTTAACAGTAGACACCTGG + Intergenic
1011068664 6:83358577-83358599 TCACTTTAACAGTAGACACCTGG - Intronic
1012285512 6:97382767-97382789 TCATTTCAACAATGTTAACCAGG - Intergenic
1012730107 6:102871583-102871605 TCATTTTAATAGTAGACACCTGG - Intergenic
1012820443 6:104080196-104080218 TCATTTTAACAGTAGACACCTGG - Intergenic
1012921164 6:105222221-105222243 TCATTTTAACAGGAGACACCTGG + Intergenic
1014267170 6:119293070-119293092 TCATCTTAACAGTCTTCAATAGG - Intronic
1014534577 6:122599390-122599412 TCACTTTAACAGTAGACACCTGG + Intronic
1014631369 6:123794573-123794595 TCACTTTAACAGTAGACACCTGG - Intergenic
1014950684 6:127551351-127551373 TGATGTTAACTGTGATCACCTGG - Intronic
1014964260 6:127727423-127727445 GCATTTGAACAGTGTCCAGCAGG + Intronic
1014969883 6:127801449-127801471 TCACTTTAACAGTAGACACCTGG - Intronic
1015467299 6:133560978-133561000 TCACTTTAACAGTGGACACCTGG + Intergenic
1015475368 6:133654570-133654592 TCACTTTAACAGTGGACACCTGG - Intergenic
1016219837 6:141654856-141654878 TCACTTTAACAGTAGACACCTGG - Intergenic
1016576621 6:145575349-145575371 TCATTTTAACAGTAGACACCTGG + Intronic
1016868954 6:148798024-148798046 TGAATTTGAGAGTGTTCACCCGG + Intronic
1017228190 6:152043839-152043861 TCACTTTAACAGTAAACACCTGG + Intronic
1018107698 6:160504559-160504581 TCACTTTAACAGTAGACACCTGG + Intergenic
1018123350 6:160658285-160658307 TCACTTTAACAGTAAACACCTGG + Intronic
1018439380 6:163795423-163795445 CCATTTTAACAGTGTTCTGCTGG - Intergenic
1020396343 7:7722780-7722802 TCACTTTAACAGTAGACACCTGG - Intronic
1020567731 7:9818502-9818524 TCACTTTAACAGTGGACACCTGG + Intergenic
1020709951 7:11594862-11594884 TCACTTTAACAGTAGACACCTGG - Intronic
1021021411 7:15602909-15602931 TCATTTTTACGGTGGTCTCCAGG + Intergenic
1022078519 7:26997592-26997614 TCACTTTAACAGTAGACACCTGG - Intergenic
1023569058 7:41553647-41553669 TCAATTTGCCAGTCTTCACCAGG + Intergenic
1024001690 7:45194190-45194212 TCATTTTAACAGTGCTCCAGGGG + Intergenic
1024958633 7:54951834-54951856 TCACTTTAACAGTAGACACCTGG + Intergenic
1025289891 7:57707998-57708020 TCAGTTTGTCAGTGTTCTCCTGG + Intergenic
1027407176 7:77873813-77873835 TCACTTTAACAGTAGACACCTGG + Intronic
1027449504 7:78314583-78314605 ACAGTTTAAGAGTGTTAACCAGG + Intronic
1027589356 7:80098413-80098435 ACATTTTAAGAGGGTTCATCAGG - Intergenic
1028043503 7:86088715-86088737 TCAATTTAACAGTAGACACCTGG - Intergenic
1028797314 7:94918197-94918219 TCACTTTTACAGTTTTCTCCTGG + Intronic
1029960873 7:104688414-104688436 TCACTTTAACAGTAGACACCTGG - Intronic
1030277082 7:107733356-107733378 TCACTTTAACAGTAGACACCTGG - Intergenic
1031383702 7:121119528-121119550 TCATTTTAAGAGTTTTGGCCGGG + Intronic
1031474798 7:122208092-122208114 TCACTTTAACAGTAGACACCTGG + Intergenic
1031779482 7:125942998-125943020 TCACTTTAACAGTAGACACCTGG + Intergenic
1033075838 7:138249952-138249974 TCACTTTAACAGTGGACACCTGG - Intergenic
1034455878 7:151169504-151169526 TGACTTTAACAGTGTTCACTAGG - Intronic
1034581320 7:152045205-152045227 TTTTTTTATCAGTGTTCATCAGG + Intronic
1036716471 8:11128906-11128928 TCCTTTTAACCTTGTTCCCCTGG + Intronic
1037046449 8:14310788-14310810 TTATTTTAAAAATGTTCACATGG - Intronic
1037982266 8:23262617-23262639 TCAGATTAACAAGGTTCACCAGG - Intergenic
1039717364 8:40124156-40124178 ACATTTGCAAAGTGTTCACCAGG - Intergenic
1040916509 8:52570576-52570598 TCACTTTAACAGTAAACACCTGG + Intergenic
1041295964 8:56357696-56357718 TCACTTTAACAGTAGACACCTGG - Intergenic
1041443355 8:57923361-57923383 TGATTTTAACCTTGATCACCTGG - Intergenic
1041585890 8:59518801-59518823 TCCTTTTAACAGTTTTCTTCTGG - Intergenic
1041880512 8:62744574-62744596 TCATCTTAATAGAATTCACCAGG - Intronic
1043100550 8:76039827-76039849 TCACTTTAACAGTAGACACCTGG + Intergenic
1043539392 8:81242483-81242505 TCACTTTAACAGTAGACACCTGG + Intergenic
1044202028 8:89449730-89449752 TCACTTTAACAGTAGACACCTGG - Intergenic
1044521889 8:93208331-93208353 TCATTGCAACACTGTTCACAAGG + Intergenic
1044785966 8:95793162-95793184 TCAGAATAACAGTGTTCAGCAGG + Intergenic
1045064011 8:98429378-98429400 TCATTTAAACTGAGTTCACTTGG - Exonic
1045065402 8:98439543-98439565 TCCTTTTGACATTATTCACCTGG - Intronic
1045465416 8:102465050-102465072 CTATTTCAACATTGTTCACCAGG + Intergenic
1046418018 8:113940576-113940598 TCACTTTAACAGTAGACACCTGG + Intergenic
1046586145 8:116150376-116150398 TCATTTTAACAGTAGACACCTGG + Intergenic
1047020726 8:120772545-120772567 ACATTTTAAAAGTGTGCCCCTGG - Intronic
1047564616 8:126030152-126030174 TCATATCAACAGTCTTCACAAGG + Intergenic
1047781790 8:128117611-128117633 TCCTTTCAACAGTGTTCCCAGGG - Intergenic
1048249368 8:132848108-132848130 TGAATTTAACCGTGTTCACCAGG - Exonic
1048654739 8:136523117-136523139 TCATTTTAACAGTAGTCACCTGG + Intergenic
1049401519 8:142429712-142429734 TCATTTACTCAGAGTTCACCTGG + Intergenic
1049972233 9:831477-831499 ACATTTTAACAATTTTCACTGGG + Intergenic
1050172776 9:2840188-2840210 TTATGTTAACCGTGTTCACTTGG + Intronic
1050447424 9:5739882-5739904 TCACTTTAACAGTAGACACCTGG + Intronic
1051253984 9:15192889-15192911 TCATTTTTACAGTGTCTAGCAGG + Intronic
1051881760 9:21847884-21847906 TCACTTTAACAGTAGACACCTGG - Intronic
1051966047 9:22831480-22831502 TCACTTTAACAGTAGCCACCTGG - Intergenic
1052789347 9:32860024-32860046 TCACTTTAACAGTAGACACCTGG + Intergenic
1054994614 9:71371642-71371664 TCATTTCAACAGTGTTCACCTGG - Intronic
1057046216 9:91888201-91888223 TGATTTTAACTGTGTTTCCCAGG + Intronic
1057051370 9:91926694-91926716 TGATTTCATCAGGGTTCACCCGG - Intronic
1060565427 9:124586829-124586851 TCATTTTAACAGTGTTCACCAGG - Intronic
1060987752 9:127829551-127829573 TCATCTTGACATTATTCACCAGG - Intronic
1186173897 X:6905129-6905151 TCATCTTAACAGTGATAACTTGG + Intergenic
1186470167 X:9814839-9814861 TCACTTTAACAGTAGACACCTGG + Intronic
1187781419 X:22830443-22830465 TCAATTTCACAGTTTTCACATGG + Intergenic
1187994008 X:24905856-24905878 TCATTTAAAAAGTGTTGGCCAGG - Intronic
1191630457 X:63315968-63315990 TCACTTTAACAGTAGACACCTGG + Intergenic
1191759002 X:64627152-64627174 TTACTTTAACAGTATACACCTGG - Intergenic
1191769849 X:64742866-64742888 TCACTTTAACAGTAGACACCTGG + Intergenic
1192661927 X:73050514-73050536 TCACTTTAACAGTAGACACCTGG + Intergenic
1192940740 X:75909363-75909385 TCACTTTAACAGTAAACACCTGG - Intergenic
1192995868 X:76512825-76512847 TCATTTTTACAATGGACACCTGG - Intergenic
1193239869 X:79155614-79155636 TAATCTTAACAATGTTCCCCAGG + Intergenic
1193433258 X:81438179-81438201 TCACTTTAACAGTAGACACCTGG + Intergenic
1193832578 X:86307360-86307382 TCACTTTAACAGTAGACACCTGG - Intronic
1193879176 X:86900498-86900520 TCACTTTAACAGTAGACACCTGG + Intergenic
1193904236 X:87223797-87223819 TCACTTTAACAGTAGACACCTGG - Intergenic
1193920440 X:87418639-87418661 TCATCTTGACAATGTTCACTTGG + Intergenic
1194032364 X:88832597-88832619 TCACTTTATCAGTGGACACCTGG + Intergenic
1194179950 X:90698715-90698737 TCATTTTAACAGTAGACACCAGG + Intergenic
1194342950 X:92728343-92728365 TCACTTTAACAGTAGACACCTGG - Intergenic
1194443219 X:93958337-93958359 TCACTTTAACAGTAGACACCTGG - Intergenic
1194491460 X:94555198-94555220 TCACTTTAACAGTAGACACCTGG - Intergenic
1194569281 X:95533334-95533356 TCCTTTTAACAGATTTCACATGG + Intergenic
1195749222 X:108147435-108147457 TCACTTTAACAGTAGACACCTGG + Intronic
1195782741 X:108482625-108482647 TCACTTTAACAGTAGCCACCTGG + Intronic
1195810030 X:108818585-108818607 TCACTTTAACAGTAGACACCTGG + Intergenic
1196275448 X:113761354-113761376 TCACTTTAACAGTAGACACCTGG - Intergenic
1196372690 X:114996900-114996922 TCACTTTAACAGTAGACACCTGG + Intergenic
1196554928 X:117075123-117075145 TCTATTTGCCAGTGTTCACCAGG + Intergenic
1197097108 X:122610080-122610102 TCACTTTAACAGTAGACACCTGG - Intergenic
1197409571 X:126098590-126098612 TCACTTTAACAGTAGACACCTGG + Intergenic
1197537256 X:127706505-127706527 TCACTTTAACAGTAGACACCTGG - Intergenic
1197591494 X:128416589-128416611 TCACTTTAACAGTAGACACCTGG - Intergenic
1197956181 X:131951115-131951137 TCACTTTAACAGTAGACACCTGG - Intergenic
1198700875 X:139397138-139397160 TCACTTTAACAGTAGGCACCTGG - Intergenic
1198783413 X:140260588-140260610 TCATTTTAACAGTAGACACCTGG + Intergenic
1198840276 X:140849156-140849178 TCATGTAAACAGTGTTCTTCTGG - Intergenic
1199275694 X:145939713-145939735 TCACTTTAACAGTAGACACCTGG - Intergenic
1200205368 X:154311830-154311852 TTATTTTACCAGTGTGCTCCTGG + Intronic
1200526605 Y:4280884-4280906 TCACTTTAACAGTAGACACCTGG + Intergenic
1200651310 Y:5845009-5845031 TCACTTTAACAGTAGACACCTGG - Intergenic