ID: 1060568462

View in Genome Browser
Species Human (GRCh38)
Location 9:124615419-124615441
Sequence AGGATTTTAAAGGTGCTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060568462_1060568467 17 Left 1060568462 9:124615419-124615441 CCATATAGCACCTTTAAAATCCT 0: 1
1: 0
2: 2
3: 14
4: 209
Right 1060568467 9:124615459-124615481 ATTCTATAGAGGTCAAACACTGG No data
1060568462_1060568466 6 Left 1060568462 9:124615419-124615441 CCATATAGCACCTTTAAAATCCT 0: 1
1: 0
2: 2
3: 14
4: 209
Right 1060568466 9:124615448-124615470 GTATATGGTGAATTCTATAGAGG No data
1060568462_1060568464 -9 Left 1060568462 9:124615419-124615441 CCATATAGCACCTTTAAAATCCT 0: 1
1: 0
2: 2
3: 14
4: 209
Right 1060568464 9:124615433-124615455 TAAAATCCTGCATGTGTATATGG No data
1060568462_1060568468 30 Left 1060568462 9:124615419-124615441 CCATATAGCACCTTTAAAATCCT 0: 1
1: 0
2: 2
3: 14
4: 209
Right 1060568468 9:124615472-124615494 CAAACACTGGAAACTAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060568462 Original CRISPR AGGATTTTAAAGGTGCTATA TGG (reversed) Intronic
902682280 1:18051793-18051815 GAGATGTTAAAGGTGCTATGGGG - Intergenic
902739817 1:18429462-18429484 AGCCTTTTTAAGGTTCTATATGG + Intergenic
904156345 1:28486415-28486437 ATGATTTCACAGGTGATATATGG + Intronic
904701286 1:32359828-32359850 TGGAATTTTAAGGTGCTCTAGGG + Intronic
907921095 1:58912528-58912550 AGCATTTTACATGTGTTATATGG + Intergenic
909109928 1:71462301-71462323 AAGATTTTAAAGCTGGTATTTGG + Intronic
909393666 1:75144485-75144507 ATGTTTTTAAAGGTGGTAAAGGG + Intronic
910304260 1:85743510-85743532 AGGATATCATAAGTGCTATAAGG - Intronic
911783957 1:101921067-101921089 AGTATTTTAAAGATGCTCAATGG + Intronic
911907978 1:103594015-103594037 AGGTTTTTTAAGGTGCCATCTGG + Intergenic
912115324 1:106399746-106399768 ATGAATTTAATGGTGATATAAGG + Intergenic
912328485 1:108793511-108793533 AGGATTTCAAAGTTGTAATATGG + Intronic
912609634 1:111029984-111030006 AGGTTTTCTAAGGTGCTATTTGG - Intergenic
913302787 1:117389674-117389696 AGCAATTTAAAGGTCTTATAAGG + Intronic
913917399 1:124790526-124790548 AGGGTTTCAAAGCTGCTCTATGG - Intergenic
913918835 1:124807360-124807382 AGGGTTTCAAAGCTGCTCTATGG - Intergenic
913924117 1:124870365-124870387 AGGGTTTCAAAGCTGCTCTATGG - Intergenic
914973456 1:152333536-152333558 AGGTTTTTAAATGTCCTTTAGGG + Intergenic
915217688 1:154350873-154350895 GGGATTTTAAATGTTCCATATGG + Exonic
916378499 1:164182536-164182558 AGCATTTTAAAAGTAGTATAAGG + Intergenic
919526826 1:198664034-198664056 AGTATGTTAAAGATGCTATGGGG + Intronic
923216502 1:231852987-231853009 AATATTTTAGAGCTGCTATAAGG - Intronic
923713790 1:236407840-236407862 AGGAATTTAAAGGGGAAATACGG - Intronic
1064000376 10:11658836-11658858 AAGATTTTAAAGGTGTTTGAGGG - Intergenic
1066531566 10:36346128-36346150 AGGATTTTAATGGTGCTGGCAGG + Intergenic
1067521268 10:47008400-47008422 AGAATTTTAAAGGTGCTCTATGG - Intergenic
1068821781 10:61385519-61385541 AGAATTTTAAAACTGTTATAAGG + Intergenic
1069202508 10:65638893-65638915 AGGATTTAAAAGGTGGCATGAGG + Intergenic
1069310323 10:67027105-67027127 AGAATTCTAGAGATGCTATAAGG - Intronic
1070084353 10:73221445-73221467 AGCATTTTAAAAGTACTAGAAGG - Intronic
1071684840 10:87743802-87743824 AGTATTTGAAAAGTGCTAGAAGG + Intronic
1072403442 10:95128033-95128055 AGGTTCTTCAAGGTGCTATCTGG + Intergenic
1074248321 10:111716418-111716440 AGGTTTTAAAAGGTTCTTTAGGG + Intergenic
1074638826 10:115354484-115354506 AGCATATTAAAAGTGCTAAAGGG - Intronic
1075658795 10:124179345-124179367 AGGAGATTAAAGGTGGGATATGG + Intergenic
1075775787 10:124985985-124986007 AAGATTTTAAAAATGCAATAAGG + Exonic
1075897787 10:126012909-126012931 AGGATTTAAAATGTGCTAAATGG + Exonic
1076933572 10:133551847-133551869 AGGTTTTTCAAGTTGGTATAAGG + Intronic
1078480947 11:11674857-11674879 AAGTTTTTAAAAGTGCTACAAGG - Intergenic
1079266095 11:18934492-18934514 AGGATTTTAGAGATGGTATGGGG + Exonic
1080938648 11:36888985-36889007 AAGATTTTACAGGTGGTAAATGG - Intergenic
1081943960 11:46972046-46972068 AGAATTTGAATGGTACTATAGGG - Intronic
1082899232 11:58227955-58227977 AGGATGTCAAAGGTGCTCTGAGG - Exonic
1084281041 11:68094046-68094068 AGCATTTTAAATGTGTTACAAGG - Intronic
1085220795 11:74872375-74872397 TGGTTTTTCAAGGTGCTATCTGG - Intronic
1085817662 11:79757586-79757608 AGCATTTTAGAGGTGCTAGATGG + Intergenic
1085868948 11:80326772-80326794 AGGTTGTTAAAGATGATATATGG - Intergenic
1086002221 11:81997359-81997381 ATGATTATAAAGGTGCCTTATGG + Intergenic
1086475774 11:87171654-87171676 ATGATCTTTAAGGTCCTATATGG + Intronic
1090154915 11:124426995-124427017 AGGATGTGAAGGGTGCTTTAGGG + Intergenic
1091945594 12:4538613-4538635 ACAATTTGAAAGGTGCAATAAGG + Intergenic
1093838982 12:23872788-23872810 AGGATTTTAAAGATTGCATATGG + Intronic
1094442577 12:30494980-30495002 AGGATTTTAATGATGCTACATGG - Intergenic
1094746223 12:33347087-33347109 AGGAGTTTAAGGGTGCAATGAGG + Intergenic
1095363953 12:41378979-41379001 TGTTTTTCAAAGGTGCTATATGG + Intronic
1097324762 12:58263897-58263919 ATGATTTTAAAACTTCTATAAGG - Intergenic
1098189286 12:67930919-67930941 AAGCTTTTAAAGAGGCTATAAGG + Intergenic
1099247961 12:80216509-80216531 AGGTTTTTAAAAGATCTATATGG - Intronic
1099413105 12:82356370-82356392 AGGATCTTAAAGGGTATATATGG - Intronic
1100096974 12:91052350-91052372 AGGAATTTAAAGGTAATATATGG - Intronic
1100699609 12:97132551-97132573 TGGATTTCAAAGTTGCTATTTGG + Intergenic
1100770872 12:97921673-97921695 AAGATTTGAAAGCTGCTAAAAGG - Intergenic
1103484263 12:121272551-121272573 CTGATTTTGAAGGGGCTATAGGG - Intronic
1105743188 13:23350467-23350489 AGGATTTTAAATGTAATACAAGG + Intronic
1106054442 13:26225370-26225392 AGGCTGTTAAAAGAGCTATAAGG - Intergenic
1107079466 13:36359195-36359217 AGGAGTTTAAAGGCAATATAGGG - Intronic
1107804404 13:44140823-44140845 AGGATTTTAAAGGTAATTCATGG + Intergenic
1108343559 13:49521514-49521536 ATGATTGTAGAGGTGCTATTTGG - Intronic
1110164146 13:72417623-72417645 AGGCTTTTAATGTAGCTATAAGG + Intergenic
1111012081 13:82326463-82326485 AGGTTTTTCAAGGTGCTATCTGG - Intergenic
1113012778 13:105789527-105789549 AGGATTTTTAAGGTTATCTAGGG - Intergenic
1114641639 14:24226678-24226700 AGCATTTTTATGGTGCTACAAGG + Intronic
1120278314 14:82407117-82407139 AGGATTTCAAAGGTGTGTTATGG + Intergenic
1120672679 14:87382098-87382120 AAGAATTTAAAGTTGCTTTAAGG + Intergenic
1125068269 15:35518709-35518731 TGGATTTTAAAAGTCCTATCTGG - Intronic
1128985722 15:72219606-72219628 AGGATTGTAAAGAGGCAATATGG - Intronic
1129900284 15:79143000-79143022 AGAATTTTAAAGGAGTTAGATGG + Intergenic
1131662551 15:94533698-94533720 AGTTTTTTAAAGTTGCAATATGG - Intergenic
1132169277 15:99631166-99631188 AGAATTTTTTAGGTGATATAAGG + Intronic
1133788945 16:8994394-8994416 AGGTTTTGCAAGATGCTATAAGG + Intergenic
1137342396 16:47621469-47621491 AGGATATTTAAGGTGATTTAAGG + Intronic
1138736432 16:59255868-59255890 AGTAATTTAAAGGTGGAATATGG + Intergenic
1138803074 16:60058585-60058607 AGGGTTTTATAGGTGCAATGAGG + Intergenic
1139025575 16:62813666-62813688 AGAATTTAAAAGTAGCTATAAGG + Intergenic
1140181701 16:72726545-72726567 AGGATTTTGAATGTTATATATGG + Intergenic
1140265627 16:73418092-73418114 AGGATTTAGAAGGTTCTAGAAGG - Intergenic
1142579483 17:932571-932593 TGGATTTTAAAGGATCTCTAGGG + Intronic
1143778506 17:9216264-9216286 GGGATTTTAATTGTGCTACAGGG + Intronic
1143938032 17:10507829-10507851 AGGATATTAAATGTACTCTATGG - Intronic
1144108037 17:12003881-12003903 AGGATATAGAAGGTGCCATAAGG + Intergenic
1146411827 17:32592628-32592650 GGTATTTTTAAGGTGCTATATGG - Intronic
1147995309 17:44356824-44356846 AACATTTTATAGGTTCTATAAGG - Intronic
1151009364 17:70475706-70475728 ATGATCTTAAAGTTGCTACATGG - Intergenic
1153174923 18:2360380-2360402 AGAATTATACAGGTGCTATCTGG - Intergenic
1155799452 18:30082126-30082148 AGGATGTTAATGGTGCTTCAGGG + Intergenic
1157785571 18:50479045-50479067 AGGATTTTAAAGGTAAAATGAGG + Intergenic
1157818073 18:50745262-50745284 AGCATTGTAAAGGTGCCACATGG - Intergenic
1159732397 18:72045420-72045442 AGTAGTTTAGAGGTGCTATGAGG + Intergenic
1164672739 19:30082255-30082277 AGGAAATTTAAGGTGCAATACGG + Intergenic
1166064542 19:40349520-40349542 GGGATTGGAAAGGTGCCATAAGG - Intronic
1166610725 19:44192692-44192714 AGTATTTTAAAGCTGGAATAAGG + Intergenic
1168182720 19:54673203-54673225 AGGTTTTTTAAGGTGCTATTTGG - Intronic
926619867 2:15037708-15037730 AAGATTGTAAAGGTGTTATCAGG - Intergenic
926685527 2:15695008-15695030 TGAATTTTAAAAGTGTTATAAGG + Intronic
926719262 2:15947109-15947131 AGGATTGTACAGGTGCAAAAAGG - Intergenic
926944217 2:18169633-18169655 AGCACTTTGAAGGTGCTAAATGG + Intronic
927273646 2:21241653-21241675 AGGAATTTACAGATGCTATGTGG - Intergenic
928305220 2:30164491-30164513 AGGTTTTTAAAATTACTATATGG - Intergenic
928604425 2:32932302-32932324 AGCATTTTAAAGGTGCTTTTTGG + Intergenic
931550933 2:63445478-63445500 AGGATTTTAAAGTTACATTAGGG - Intronic
933296900 2:80501568-80501590 AGAATTTTAAAGGTATGATATGG - Intronic
937856736 2:126677827-126677849 AGCATCTTAAAAGTGCTTTAAGG - Intronic
938010022 2:127821504-127821526 AGGTTTTCCAAGGTGCTATCTGG - Intergenic
938772425 2:134511708-134511730 AAGATTTTAAAGGTACTCTCAGG + Intronic
939385934 2:141498335-141498357 AGGATTTTAAAGATGTTGTCTGG - Intronic
940442419 2:153733671-153733693 AGGCATTTAAAGCTGCTATTGGG + Intergenic
940683881 2:156821843-156821865 AGGTTCTTGAAGGTGCTAAAAGG + Intergenic
940989920 2:160086533-160086555 AGGTTTTCCAAGGTGCTATCTGG + Intergenic
941291746 2:163684358-163684380 AGGATTTTAAAAATGCAAAAAGG - Intronic
941595697 2:167474320-167474342 AAGATTGTAAATGTGCTAAATGG - Intergenic
942502276 2:176604213-176604235 AGGATGATAAGGGTGATATAAGG + Intergenic
944488277 2:200230216-200230238 ATCATTTTGAAGCTGCTATAAGG - Intergenic
1171086110 20:22239623-22239645 AGGATTTTCACAGTGGTATATGG + Intergenic
1171334767 20:24373499-24373521 AGGATTTTAAGGGTTTTAGATGG + Intergenic
1172017474 20:31886417-31886439 AGGATTTGAAAGGTCCAATTGGG + Intronic
1172285909 20:33740325-33740347 AGGAATGTAAATGTGCTATGTGG - Intronic
1173233669 20:41223676-41223698 AGAATTTAAAAGGGGCTACAGGG - Intronic
1179637704 21:42724090-42724112 AGGATTCCAGAGGTGCTAGAGGG + Intronic
1182164149 22:28155501-28155523 AGAATTTTAAAAGTGTTATTAGG + Intronic
949263336 3:2127788-2127810 AGTGTTTAAAAGGTGCTACAGGG + Intronic
949857859 3:8478336-8478358 AGAATTTTAAAGAAGCTATTAGG + Intergenic
956130890 3:66052970-66052992 ATGATACTAAAGGAGCTATATGG - Intergenic
956229785 3:67000471-67000493 AGGATTATAAAGATTATATAAGG - Intronic
956307726 3:67844755-67844777 AGGATGTCAATAGTGCTATAAGG - Intergenic
957968151 3:87347590-87347612 AAGATTTTAAAGGTAATATTAGG + Intergenic
958896933 3:99839797-99839819 AGGTTTTTAAAGTTGCTTTGAGG + Intronic
961155607 3:124677028-124677050 AGGATTTTAAGGGTACTTTGAGG - Intronic
963874908 3:150464158-150464180 AGTATTTTACAGTTGTTATATGG - Exonic
963901950 3:150741519-150741541 CAGATTTTAAAGGTGCTTTAAGG - Exonic
964095949 3:152931873-152931895 AGAATTTGAAAGGTGCTATATGG - Intergenic
970267903 4:14309736-14309758 AAGATTTTAAAACTGCAATACGG - Intergenic
970663479 4:18311691-18311713 AGGATTTTGGAGGGGCCATAGGG - Intergenic
972944765 4:44240736-44240758 AGCATTTTAAAGCTGTTTTAAGG - Intronic
973692713 4:53454696-53454718 AGGATTTTCAGGGTGGTAAATGG + Intronic
974373607 4:61048445-61048467 AGTGTTTTAAAAGTACTATACGG + Intergenic
974647086 4:64708990-64709012 AGGATTTTCAAAGTCCTAGATGG - Intergenic
974787540 4:66639002-66639024 AAGATTTTAAAGGTCCTGTGGGG - Intergenic
975479909 4:74866288-74866310 AGAATCTTAAAGGTGATACAAGG + Intergenic
975506292 4:75142158-75142180 AAGATTTTAAAAGTGCAACAAGG + Intergenic
977988004 4:103407691-103407713 ACGCTTTTAAAAGTGCTAGAAGG - Intergenic
978757837 4:112323439-112323461 AGGATCTGTAAGGTGATATAAGG - Intronic
978950330 4:114550790-114550812 AGGATTATAAAGGTTATAAAAGG - Intergenic
980602865 4:135047515-135047537 AGGATATTCAAAGTGCTCTAAGG - Intergenic
981860618 4:149351639-149351661 AGAATTTTAAAGTTTCTTTATGG + Intergenic
982967625 4:161933625-161933647 AGGATTTTCAAGGTGGAAAATGG + Intronic
983687282 4:170425635-170425657 AGCATTTTGAATGTTCTATACGG - Intergenic
983995937 4:174181826-174181848 AGGATTTGTGAGGTCCTATAGGG + Intergenic
985173337 4:187175231-187175253 ATTTTTTTAAACGTGCTATATGG + Intergenic
989125859 5:38051868-38051890 AAGTTTTGAAAGGTGCTACAAGG + Intergenic
989428487 5:41324380-41324402 AGGATTTTTAAGGTACTAGCCGG - Intronic
989808134 5:45637732-45637754 AGGATTTGAAATGTGGTATTTGG + Intronic
990031658 5:51267842-51267864 AGGATTTTAGAGAAGCTATTTGG - Intergenic
992131461 5:73697052-73697074 AACATTTTTAAGGTACTATATGG + Intronic
992751038 5:79861263-79861285 AAAATTTTATAGGTGCTCTAGGG + Intergenic
994691844 5:103029121-103029143 AGAACTTTAAACGTGCTAAAGGG - Intronic
995204790 5:109467283-109467305 AGCTTATTAAAGGAGCTATATGG - Intergenic
996171515 5:120298116-120298138 TGCATTTGAAAGCTGCTATATGG - Intergenic
996612822 5:125404170-125404192 AGGATTTTAATGGTGCCTTCTGG - Intergenic
1001874874 5:175191300-175191322 GGGCTTTTACAGGTGCTAGAAGG - Intergenic
1002456707 5:179349470-179349492 AAAATTTTAAAGGGGCTATCTGG + Intergenic
1005145082 6:22680317-22680339 AGGATTTAAAAGTTTGTATAAGG - Intergenic
1005232240 6:23715860-23715882 AGCATTGTAAAGGAGCTTTATGG - Intergenic
1006088432 6:31613567-31613589 AGTATATTAAAGGTGCTAGGTGG - Intergenic
1008396406 6:51012757-51012779 GGTATTTTTAAGGTGCTATATGG + Intergenic
1008464343 6:51814070-51814092 AGGATTTTTAAACTGCTAAAGGG - Intronic
1009855117 6:69252625-69252647 AGGATTTAAAATGGCCTATAAGG - Intronic
1010918352 6:81649292-81649314 GAGATTTTAAAGCTGGTATAGGG - Intronic
1014420434 6:121237189-121237211 AGCATCTTAAATGTGCTAAATGG - Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1017570571 6:155740680-155740702 AGGATTTTAAAGCTGTTAGCTGG + Intergenic
1018497329 6:164362400-164362422 AGGATTTTAAAGGTTTGATATGG + Intergenic
1018701786 6:166433032-166433054 ATGAATTTTAAGGTGTTATAAGG + Intronic
1021245477 7:18256392-18256414 TGGATTTTAGAGGAGCTAGATGG + Intronic
1022019531 7:26384915-26384937 ACGTCTTTTAAGGTGCTATAAGG + Intergenic
1023469727 7:40502906-40502928 CGTATTTTAAAAGTCCTATATGG + Intronic
1025868176 7:65405560-65405582 AGGTTTTCCAAGGTGCTATCTGG - Intergenic
1026196337 7:68176833-68176855 AGCATTTTAAAGATGATTTATGG + Intergenic
1027934657 7:84587468-84587490 AGGATTTTAAAAGTTGTATAAGG + Intergenic
1028055945 7:86243585-86243607 GGCATTTTATAGGTGCCATAAGG - Intergenic
1030379424 7:108795348-108795370 AGGCTGTTAAAGTAGCTATAAGG + Intergenic
1034000128 7:147402619-147402641 AGCATTTTATAGGCCCTATAGGG + Intronic
1039175779 8:34804372-34804394 TGGATTTTAAAGTTGCCATCTGG + Intergenic
1039345608 8:36701966-36701988 AAGATTGTAAAGGAGCTATTGGG - Intergenic
1040943573 8:52857470-52857492 GGAAATTTAGAGGTGCTATAAGG - Intergenic
1041689676 8:60677048-60677070 AGTATATGAAAGGTGCTTTAGGG - Intergenic
1042230888 8:66553269-66553291 AGGATTTTAAAGGCCCCTTAGGG + Intergenic
1042704946 8:71656236-71656258 TGGATTTGAAAGGTGATAGATGG - Intergenic
1043047492 8:75345141-75345163 AGCATTTTAAAACTGCAATAAGG + Intergenic
1043441024 8:80277209-80277231 AGGATTTCAAAGGAGATATCAGG + Intergenic
1043587385 8:81784770-81784792 AGGAGGTTACAGGTGCTACAGGG + Intergenic
1045335514 8:101200195-101200217 AGGAATTTAAAGGTGTTTTTGGG - Intronic
1046149085 8:110200166-110200188 AGGATTTTGAAGCAGCTCTAAGG - Intergenic
1046472640 8:114697651-114697673 AGAATTTTAAAGATGTTAAAAGG - Intergenic
1047375964 8:124296307-124296329 GGGATTATAAAGGGGCCATAAGG - Intergenic
1048412449 8:134189484-134189506 AGCATTGTAAAGGAGCTTTATGG - Intergenic
1053185673 9:36014078-36014100 AAGATTTGAAAGCTGCTATGAGG + Intergenic
1056233815 9:84572182-84572204 AGAATTTTATAAGTGCTATCTGG - Intergenic
1057833899 9:98428731-98428753 GGGATTTTGCTGGTGCTATAAGG + Intronic
1059012618 9:110478452-110478474 AGCAGGTTAAAGGTGCTATAAGG - Intronic
1059667300 9:116460660-116460682 AGGATTGCAAAGGAACTATATGG + Intronic
1059932647 9:119276473-119276495 TTGATGTTAAAGGTTCTATAAGG - Intronic
1060568462 9:124615419-124615441 AGGATTTTAAAGGTGCTATATGG - Intronic
1203339724 Un_KI270322v1:20471-20493 AGGGTTTCAAAGCTGCTCTATGG + Intergenic
1187025146 X:15427230-15427252 AGGATTTTAAAGGGGCTTCTGGG + Intronic
1187425996 X:19177624-19177646 AGGATTTCAAAGGTACTGGAGGG + Intergenic
1188149272 X:26652165-26652187 AGGTTCTTTAAGGTGCTATCTGG + Intergenic
1189321136 X:40088286-40088308 ACGATTTTAAAGGTAGTGTATGG - Intronic
1189811231 X:44782350-44782372 ATGATTTTAAATGTGATATAAGG + Intergenic
1190539066 X:51458607-51458629 AGGTTTTCTAAGGTGCTATTTGG - Intergenic
1190718934 X:53130821-53130843 AGGAATTTGAAGGTGTTATTTGG + Intergenic
1194356965 X:92897292-92897314 AATATATTAAAGGTCCTATATGG - Intergenic
1194734691 X:97497934-97497956 AAGTTTTTAAAGGTAATATAGGG + Intronic
1195674351 X:107496469-107496491 AGGATTTCAAAAGTGTTAGAAGG - Intergenic
1196179700 X:112676458-112676480 AGGTTTTTAAATCTGCTAGATGG + Intronic
1196675126 X:118412201-118412223 AGTATGTTAAAGGTACTACAAGG + Intronic
1200665297 Y:6014286-6014308 AATATATTAAAGGTCCTATATGG - Intergenic