ID: 1060571385

View in Genome Browser
Species Human (GRCh38)
Location 9:124643514-124643536
Sequence TGCTGGAGCCCAAGAGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060571378_1060571385 9 Left 1060571378 9:124643482-124643504 CCCAGGTACTCGGGAGGTTGAGG 0: 34
1: 3573
2: 115852
3: 304551
4: 222218
Right 1060571385 9:124643514-124643536 TGCTGGAGCCCAAGAGACGAAGG No data
1060571376_1060571385 17 Left 1060571376 9:124643474-124643496 CCTGTAGTCCCAGGTACTCGGGA 0: 646
1: 58057
2: 182596
3: 270902
4: 190801
Right 1060571385 9:124643514-124643536 TGCTGGAGCCCAAGAGACGAAGG No data
1060571380_1060571385 8 Left 1060571380 9:124643483-124643505 CCAGGTACTCGGGAGGTTGAGGT 0: 4
1: 390
2: 12198
3: 151628
4: 318121
Right 1060571385 9:124643514-124643536 TGCTGGAGCCCAAGAGACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060571385 Original CRISPR TGCTGGAGCCCAAGAGACGA AGG Intronic
No off target data available for this crispr