ID: 1060575150

View in Genome Browser
Species Human (GRCh38)
Location 9:124685111-124685133
Sequence ATGAAGAAACAGATTTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1168
Summary {0: 1, 1: 1, 2: 22, 3: 163, 4: 981}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060575150 Original CRISPR ATGAAGAAACAGATTTAGAA GGG (reversed) Intronic
902914842 1:19631033-19631055 ATGAAGAAACAGTTTTTGGAAGG + Intronic
903091877 1:20927617-20927639 AAGAAGAGACAGATCCAGAAGGG + Intronic
903133040 1:21291393-21291415 GTGAATAAACAGGTTTAGAGGGG + Intronic
903289439 1:22298665-22298687 GTGAAGAAACAGGTTCAGACAGG + Intergenic
903423169 1:23233290-23233312 ATGAGGAAACAGATTTAGAGAGG + Intergenic
904067076 1:27761649-27761671 ATGAATGAACAGATTAAAAATGG + Intronic
904534707 1:31191502-31191524 TTGAAGAAATAGATTCAGAGAGG - Intronic
904804816 1:33123487-33123509 ATGAGTAAACAGATTCAGACAGG - Intergenic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905119856 1:35673241-35673263 GTAAAGAAAGAGATTTAGAAGGG - Intergenic
905221069 1:36448134-36448156 ATGGAGAAACAGGTTTATAGAGG + Intronic
905909775 1:41645875-41645897 ATGAGGGAACAGACCTAGAAAGG - Intronic
905976040 1:42174467-42174489 AAGAAGAAACAGCTTTGGAGAGG - Intergenic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
906754826 1:48301165-48301187 ATGAATAAACACATTTAGTAAGG + Intronic
906907301 1:49909888-49909910 ATTGAGAAACAGATTTGAAAGGG + Intronic
906938333 1:50234161-50234183 ATAAAGAAACAGAGTTTTAATGG - Intergenic
907000032 1:50843239-50843261 ATGAAGAAAAAGAATTAGGTCGG - Intronic
907076998 1:51587998-51588020 ATGAGGAAACAGGTTCAGAGAGG - Intronic
907252142 1:53146593-53146615 ATTAAGTGACAGATTTAGACGGG - Intergenic
907972575 1:59398014-59398036 CTGGAGAAACAAAATTAGAAGGG - Intronic
908017375 1:59857515-59857537 ATGGAGGAACAGATTTACAGAGG + Intronic
908096170 1:60741337-60741359 ATGAAGAAATTGATTTGAAAAGG + Intergenic
908136342 1:61137326-61137348 AGGAAAAAAGAGATTCAGAAAGG + Intronic
908406656 1:63820829-63820851 ATGGAGAAACAGATGAGGAATGG + Intronic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
908993751 1:70127170-70127192 AAGCAGAAACAGTTTTATAAAGG - Intronic
909142631 1:71888174-71888196 AAAAAGAAACTGATTTAGAATGG + Intronic
910013503 1:82494025-82494047 AGGAAGAAACAAATTTATACAGG - Intergenic
910092372 1:83480373-83480395 TTGCAGAAAAACATTTAGAAAGG + Intergenic
910187662 1:84561046-84561068 ATTAAGAAATAGATTTTGTAAGG + Intronic
910473035 1:87575962-87575984 ATGAGGAAATAGGCTTAGAATGG + Intergenic
910644462 1:89498583-89498605 ATAAAAAAATAGATTTATAAAGG + Intergenic
910905213 1:92169342-92169364 ATGACAAAACATATTTAAAAAGG - Intronic
911261579 1:95692991-95693013 ATGAAGAAACAGCTCTAGAATGG - Intergenic
911573927 1:99551613-99551635 TTAAGGAAACAGATTCAGAAAGG + Intergenic
911912530 1:103653993-103654015 ATGAAGGACCAGATATGGAAAGG - Intergenic
911915924 1:103697955-103697977 ATGAAGGACCAGATATGGAAAGG + Intronic
911919942 1:103748131-103748153 ATGAAGGACCAGATATGGAAAGG - Intronic
911978243 1:104531083-104531105 ATAAAGAAATATATTTTGAAAGG - Intergenic
912125630 1:106533940-106533962 ATGAATAAACAGATCCAGAGAGG + Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912486987 1:110036527-110036549 ATAAAGAAATGGATTTAGACAGG - Intronic
912603115 1:110959298-110959320 ATGAAGAAACAGATTCAAAGAGG - Intronic
912769345 1:112448780-112448802 CTAAAGAAACAGCATTAGAAAGG - Intronic
914256436 1:145963819-145963841 ATGAGGAAACAGACTTAATAAGG + Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914514040 1:148358469-148358491 GTGAAAGAACAGATTTGGAAGGG - Intergenic
914957184 1:152173266-152173288 ATGAAGACCCAGATAGAGAAAGG - Intergenic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
914973441 1:152333211-152333233 ATGAGGAAACAGACCCAGAAAGG - Intergenic
915171942 1:153984198-153984220 AAGAGGAAACAGATTTGGATAGG + Intronic
915251059 1:154588953-154588975 ATGAAGGGAGAGACTTAGAAAGG - Intronic
915521089 1:156444484-156444506 TTGAAAAGACAGATATAGAAGGG + Intergenic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
915710021 1:157886968-157886990 ATGAAGAAACAAACTTATAATGG + Intronic
915888004 1:159744070-159744092 ATGAAGAAACATTTCTAAAAGGG + Intergenic
916295333 1:163212909-163212931 ATAAAGACACAGATATAGGAGGG - Intronic
916444527 1:164859931-164859953 AGGAAGAAATAGAATTAGACTGG + Intronic
916667527 1:166979918-166979940 ATGAAAAAATACATTTAAAAGGG + Intronic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
917192042 1:172428324-172428346 AAGAAGATACATATTTTGAAAGG - Intronic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
918372422 1:183874471-183874493 AGGAAGAAAAAGATTATGAAAGG - Intronic
918560961 1:185867184-185867206 TGGAAGAAACAGTTTTAGAGAGG + Intronic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
919046002 1:192452943-192452965 ATGAGGAAACAGATCCAGAGAGG - Intergenic
919138989 1:193546375-193546397 ATTAAGACACAGATTCATAAAGG - Intergenic
919148332 1:193663092-193663114 ATGAAGAAATAGAGCTAGTAAGG + Intergenic
919559798 1:199102415-199102437 AAGATGAAACAGTTCTAGAAGGG - Intergenic
919578851 1:199345973-199345995 ATGAAAAACCATATTTAGAAAGG - Intergenic
919641889 1:200053430-200053452 ATGAAGAAACTGAGGCAGAAGGG + Intronic
919649838 1:200136730-200136752 TAGAAGGATCAGATTTAGAATGG - Intronic
919998579 1:202776905-202776927 ATCTAAAAACAGATTTACAATGG + Intronic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
920779979 1:208979984-208980006 ATGAGGAAACTGATCTACAATGG - Intergenic
920823855 1:209405934-209405956 CTGAAGAAACACTTTTACAATGG - Intergenic
920896878 1:210060038-210060060 ATGCTGAAACAGATGTAGCAAGG - Intronic
921039853 1:211419889-211419911 ATTAAGAAATATATATAGAAAGG + Intergenic
921113661 1:212064991-212065013 AAGAAGAAACAGAATTCAAAAGG + Exonic
921319218 1:213921800-213921822 ATGAAGAAACGAATTAATAAAGG - Intergenic
921636621 1:217503159-217503181 ATGAAGAAACGTTTTAAGAAGGG + Intronic
921732364 1:218592680-218592702 AGAAAGAAATAGATTTAAAAAGG - Intergenic
921995841 1:221417175-221417197 ATGAAGAAAGAAAGTTATAATGG - Intergenic
922022768 1:221720816-221720838 ATGATAAAAGAGATTTGGAAGGG - Intronic
922231170 1:223687983-223688005 ATAAAGATACAGATATAGAAAGG - Intergenic
922386502 1:225089493-225089515 AAAAGAAAACAGATTTAGAAAGG + Intronic
922865591 1:228858934-228858956 ATGAAAGAACAGATTTACTATGG + Intergenic
922873364 1:228920801-228920823 GTGAAGAAAGAGTTTCAGAATGG - Intergenic
923221284 1:231896340-231896362 ATGAAGAGACAGCTTTAAAATGG - Intronic
923367867 1:233280827-233280849 CAGAAGAAACAGATTTACAAAGG - Intronic
923374117 1:233342903-233342925 ATGAAGAATCCGATTTAGGATGG - Intronic
923735558 1:236603720-236603742 ATGAAGAAACAAAATTAGAGAGG - Intronic
923851359 1:237799457-237799479 ATGAAGAAATAGTTTTAAATTGG + Intronic
923866161 1:237941869-237941891 ATAAACAATCAGATTTAGAATGG + Intergenic
924074477 1:240319051-240319073 ATGAAAATACAGGCTTAGAAGGG + Intronic
924287141 1:242499427-242499449 ATGAAGATATAGATAGAGAAAGG - Intronic
924937758 1:248786602-248786624 ATGAGGAAACAGATTTGCAAAGG - Intergenic
1062775477 10:142502-142524 ATGAGGGAATAGACTTAGAAGGG + Intronic
1062945580 10:1458870-1458892 AAGAACAAACATATTTAAAAAGG + Intronic
1063061914 10:2564535-2564557 AGGTAGAAACATTTTTAGAAAGG - Intergenic
1063135335 10:3211607-3211629 ATGGGGAAACAGATTTGAAATGG - Intergenic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1064345435 10:14528528-14528550 ATGAAGAAACAGATCTCAAGAGG + Intronic
1064668521 10:17683659-17683681 ATGAAGAAATATATTAAAAAGGG - Intronic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065187902 10:23187245-23187267 AGGTGGAAACAGATTTAGAAAGG - Intergenic
1065991744 10:31017162-31017184 ATGATGAAACACTTCTAGAAAGG + Intronic
1066546012 10:36501491-36501513 ATGAAGAAGCAGATATATAAGGG - Intergenic
1066778538 10:38913209-38913231 ATAATGGAATAGATTTAGAATGG + Intergenic
1067661558 10:48239818-48239840 ATGAGGAAACAGATTCAGAGAGG - Intronic
1067667460 10:48290465-48290487 ATGAGGAAACTGGTTTAGACAGG - Intergenic
1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG + Intergenic
1068084447 10:52357820-52357842 ATTAAAAAACAGAGTTAGTATGG + Intergenic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068610876 10:59058562-59058584 CTGAAGAATCAGTTTTAGGACGG + Intergenic
1068685487 10:59866299-59866321 AAGAATAAAGAGATTTAAAATGG + Intronic
1068904203 10:62304746-62304768 AAGAAGAAAATGATTTGGAAAGG + Intergenic
1068923468 10:62510762-62510784 AAGAAGAAACAGACCTAGAGAGG + Intronic
1068968862 10:62941712-62941734 ATTAAGACAGAGATTAAGAATGG - Intergenic
1069385892 10:67883406-67883428 ATGAAGAAACAGCTTTAAGTTGG + Intergenic
1069426064 10:68289633-68289655 AAGGAGAAAGAGACTTAGAAAGG + Intronic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070376953 10:75841923-75841945 ATGAAGAAACAGAGACAGAGGGG - Intronic
1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG + Intronic
1070880937 10:79851526-79851548 ATGTAGACACAGATTTACATTGG + Intergenic
1071035721 10:81242184-81242206 ATAAAGAAAAAGAGTAAGAAAGG + Intergenic
1071074208 10:81732023-81732045 ATGAGCCAACAGATTTAGAAAGG + Intergenic
1071355910 10:84794878-84794900 ATTAAGAAACACATTCAGCAAGG - Intergenic
1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG + Intronic
1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG + Intronic
1071786854 10:88910537-88910559 ATGTAGCATCAGAATTAGAAGGG - Intronic
1071801624 10:89069666-89069688 ATGAAAAAATGGATTCAGAATGG - Intergenic
1071845134 10:89514210-89514232 AAGAAGAAAGAGATTAGGAAGGG + Intronic
1072028567 10:91492144-91492166 ATCAGGAAACAGAATTAGAGAGG - Intronic
1072197794 10:93131525-93131547 ACAAAGAAACAGATTCAGAATGG - Intergenic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1072519231 10:96215563-96215585 TAGAAGAAACATCTTTAGAATGG + Intronic
1072862406 10:99020352-99020374 ATGAGTAAACAGACATAGAAAGG + Intronic
1073028920 10:100509140-100509162 AGGAAGAAACAGAGCAAGAAAGG + Intronic
1073103931 10:101021629-101021651 AAGAAGAAACAGGTTTAGAGAGG - Intronic
1073155277 10:101341597-101341619 ATCAAGAAACATATTTTGAGAGG - Intergenic
1073180114 10:101578435-101578457 ATTAAGGAACAGCTTTAGAGAGG - Intronic
1073862063 10:107756866-107756888 ATAAAGATATAAATTTAGAAGGG + Intergenic
1074336741 10:112584118-112584140 ATAAGTAAACAGATTCAGAAGGG + Intronic
1074371338 10:112903065-112903087 AGGGAAAAACAGATTTAGAGAGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074811241 10:117107238-117107260 ATGAGGAAACAGTTTTGGGACGG + Intronic
1075250995 10:120873258-120873280 ATGAAAACACAGATTTAGTGTGG + Intronic
1075302519 10:121338132-121338154 TTTCAGAATCAGATTTAGAAGGG + Intergenic
1077651537 11:3977497-3977519 ATGAAGAAACTGAGGTGGAAAGG - Intronic
1077803128 11:5561855-5561877 AAGACTAAACAGATTCAGAAAGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078204808 11:9219312-9219334 AGGAAGAAACAAATTTACCAAGG + Intronic
1078247287 11:9585682-9585704 ATGAAGGCAAAGATTTATAATGG + Intronic
1078707441 11:13758758-13758780 ATGAAGAAACAGAATCAAAGAGG + Intergenic
1079422633 11:20308312-20308334 ATAAAGAAACAGACAGAGAAAGG + Intergenic
1079458677 11:20660571-20660593 AAGGAAAAACATATTTAGAAGGG - Intergenic
1079862480 11:25691399-25691421 AAGAAAAAACATATTTTGAATGG + Intergenic
1080113397 11:28595168-28595190 ATGAGGAGACAGAATCAGAATGG - Intergenic
1080185323 11:29476536-29476558 ATGAATAAACAGATTCATAGTGG - Intergenic
1080376682 11:31721503-31721525 TTGAATACACAGTTTTAGAAAGG - Intronic
1080538719 11:33246205-33246227 ATGGAGAAACTCATTTAGCAAGG - Intergenic
1080562858 11:33479787-33479809 ATTGAGAAACAGATTTTAAAAGG + Intergenic
1080582788 11:33657485-33657507 ATGAGGAAACAGGCTTGGAAAGG + Intronic
1080595106 11:33766054-33766076 ATGAAGAAACAGGATTAAAGAGG - Intronic
1081451730 11:43177342-43177364 AGGAAGGAACAGATATAGGATGG - Intergenic
1081583185 11:44366316-44366338 TTGAAGAAACAGACGTAGAGAGG - Intergenic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1082086479 11:48054504-48054526 GTGAGGAAACAGACTTGGAAAGG + Intronic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1083038818 11:59667409-59667431 ATGAAGACAAAGCTTTAAAACGG - Intronic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083336566 11:61925148-61925170 ATGAGGAAACAGATTTGGAAAGG + Intergenic
1083784897 11:64938752-64938774 ATAAAGAAACAGAATTGCAATGG + Intronic
1084110062 11:67008260-67008282 AGGAAAAATCAGATTAAGAAGGG - Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084885707 11:72205343-72205365 CTGAAGAAGCACTTTTAGAAGGG + Intergenic
1085218154 11:74850182-74850204 ATGAAGCAACAGACTCAGAGAGG - Intronic
1085484899 11:76854658-76854680 ATGAAGATACAGAGATAGAGTGG + Intergenic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1085887602 11:80538653-80538675 ACGAAGAAACAGCTTTGCAATGG - Intergenic
1086004275 11:82017932-82017954 ATGAAGAAACAGAGATACAGAGG + Intergenic
1086378996 11:86232195-86232217 AGGAAGAAACAGATTTAATAAGG - Intergenic
1086506848 11:87514069-87514091 AGGAAGAGACAGGGTTAGAATGG - Intergenic
1086534269 11:87825244-87825266 ATGAAGGAACAAATTAAGAAAGG + Intergenic
1086537886 11:87870546-87870568 ATAAAGAAACAAATTTAGTATGG - Intergenic
1086899066 11:92345837-92345859 TTGAGGAAACAGATTGAGACAGG - Intergenic
1087104552 11:94396843-94396865 ATGAGGAAACAGATTCAGAGAGG - Intronic
1087239584 11:95759750-95759772 ATGAAGAAAGTAATCTAGAAAGG - Intergenic
1087253820 11:95933709-95933731 ATAAAGAAACTGATCTAGATAGG + Intergenic
1087905214 11:103688122-103688144 TTGAAGACACAAAGTTAGAAAGG + Intergenic
1088026593 11:105192088-105192110 ACGAAGGAATAGATTTAGGAAGG + Intergenic
1088184297 11:107147489-107147511 ATGAAGAAACACTTCTGGAATGG - Intergenic
1088271676 11:108040879-108040901 AAGAAGAGTCAAATTTAGAAGGG - Intronic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1088584165 11:111345932-111345954 AAGAAGAAACAGACTTAAAGAGG - Intergenic
1089643032 11:119860108-119860130 AGGAGGAAACAGATTCAGAGAGG + Intergenic
1089929512 11:122296105-122296127 ATGAAGAAATAGGTTCAGAGAGG - Intergenic
1089956343 11:122574691-122574713 ACGAAGACACAGATTCTGAAAGG - Intergenic
1090084145 11:123636374-123636396 AGGAAGAAAAAGACTTGGAAAGG - Intronic
1090129329 11:124123327-124123349 ATGAAGAGACAGAGTGAGAGAGG - Intronic
1090937401 11:131355951-131355973 AGGAAGAAACAGAATATGAAAGG - Intergenic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091081704 11:132675571-132675593 ATGAATAAAGAAATTTAGCAAGG + Intronic
1091269612 11:134297993-134298015 ATGAAGAGACATCTTTAGAGTGG - Intronic
1091397354 12:162144-162166 ATGAAAAAAGAGTTTTGGAAAGG - Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091676658 12:2495933-2495955 AGGAAGAAACAGCCGTAGAAAGG - Intronic
1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG + Intronic
1092891286 12:12971501-12971523 AGGAAGAAGAATATTTAGAATGG - Intergenic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093029738 12:14277244-14277266 GTGGAGAAACAGAGATAGAAGGG - Intergenic
1093072200 12:14717283-14717305 TTGAATAAACAGATTTTAAAAGG + Intergenic
1093111701 12:15160519-15160541 ATGAAGAAACTGAGATTGAAAGG - Intronic
1093364777 12:18280436-18280458 ATGATGAAAAAGAATTAGCAAGG + Intronic
1093555137 12:20463758-20463780 ATGCAGAAAAACATTAAGAAGGG + Intronic
1093927305 12:24921795-24921817 AGCAGGAAGCAGATTTAGAAAGG - Intronic
1093936900 12:25011111-25011133 ATAAAGAAACAGGTTCAGAGAGG + Intergenic
1094344869 12:29456404-29456426 ATGATGAAACACATTTCAAAAGG + Intronic
1094381217 12:29845297-29845319 ATGAAGAAACTGAAACAGAAAGG + Intergenic
1094582574 12:31748075-31748097 ATGAGGAAACAGACTTGGAGAGG - Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095113266 12:38322094-38322116 ATTAGGAAACAGACATAGAATGG - Exonic
1095359014 12:41313192-41313214 AGGAGGAAAGAGATTTACAAGGG - Intronic
1095474015 12:42566567-42566589 ATGAAGAAACAGGTTCCAAATGG - Intronic
1095580691 12:43793286-43793308 ATGCTGAAATAGCTTTAGAAAGG - Intergenic
1095900724 12:47325398-47325420 ATGAAGAAAAATGTTCAGAAAGG + Intergenic
1095935129 12:47671672-47671694 ATGAAGATACTGATCAAGAATGG + Intronic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096479025 12:51925806-51925828 ATGCAGAAACAGACTTACAAGGG + Intergenic
1096739047 12:53678190-53678212 AGGAGGAAATAGATTTAGAGGGG - Intergenic
1097290954 12:57914522-57914544 ATGAAGACACAGACTTAGAGGGG + Intergenic
1097391227 12:59016540-59016562 ATGAAGAAATTGTTTTATAATGG + Intergenic
1097653569 12:62333661-62333683 ATTAAGAAACAGATGTAGAATGG + Intronic
1097703469 12:62844229-62844251 AGGCAGAAACAGTTTTAGCAGGG + Intronic
1097743972 12:63278894-63278916 ATGAAGTTACAGTTATAGAAGGG + Intergenic
1097824513 12:64160928-64160950 ACAAAGTAACAGAATTAGAATGG - Exonic
1097892317 12:64789956-64789978 ATTAGGAAACTGATTCAGAAAGG + Intronic
1097992498 12:65850825-65850847 ATGAAAAAAGCAATTTAGAAAGG + Intronic
1098841590 12:75484391-75484413 GTGAATAAACAGACTTAGAGAGG + Intronic
1098983916 12:76989451-76989473 AGGAATAAAGTGATTTAGAATGG - Intergenic
1099128503 12:78796461-78796483 ATCAAGAAATAGATTTTGTAAGG + Intergenic
1099134086 12:78872377-78872399 ATGATGAAACAGATTCTCAAAGG - Intronic
1099137997 12:78932474-78932496 ATGAAAATACAAATTTTGAAAGG + Intronic
1099147088 12:79059878-79059900 ATGAGGAGACAGATTCTGAAAGG + Intronic
1099211694 12:79799128-79799150 AACAAAAAAAAGATTTAGAAAGG - Intronic
1099603812 12:84776055-84776077 AAGATGAACCAGATTAAGAAAGG - Intergenic
1099619133 12:84978147-84978169 ATGATCAAACAAATTTATAAAGG + Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1099852218 12:88115132-88115154 AAAAAGAAAGAGATTTAGAAAGG - Exonic
1100066866 12:90658236-90658258 ATGAAGAAAAAAATTAAAAATGG - Intergenic
1100150959 12:91737057-91737079 ATGAGGAAACAGGTTTAGGGAGG - Intergenic
1100176207 12:92033881-92033903 ATGAAGAAAGAGAAGAAGAAAGG + Intronic
1100208716 12:92378996-92379018 ATGAAGAAAAATATTCAGGAAGG + Intergenic
1100389774 12:94138325-94138347 ATGAAGAAACAGAAGTAAATCGG + Intergenic
1100553490 12:95669569-95669591 ATGAGGAAACAAATTTGGAGAGG + Intronic
1100774237 12:97956752-97956774 AAGAAGAATCAGATTCTGAAAGG + Intergenic
1100841539 12:98617728-98617750 ATTAAGAAACAAATGTAAAATGG + Intronic
1101439692 12:104694289-104694311 ATCAGGAAACAGATTCAGAGAGG - Intronic
1101541138 12:105666548-105666570 ATGAGGAAACAGACATAGAAAGG + Intergenic
1101582736 12:106058101-106058123 GTGAAGAAACAGATTGAAAGAGG - Intergenic
1101585365 12:106080946-106080968 TTGCTGAAACATATTTAGAAAGG - Intronic
1101634186 12:106523663-106523685 AGAAAGAAAGAGATTTAGCAAGG + Intronic
1101685218 12:107012623-107012645 ATTAAGAAACACATTTTGTAAGG + Intronic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1102449240 12:113028507-113028529 ATGAACAAACACAGTGAGAAGGG + Intergenic
1102564187 12:113784026-113784048 ATGAGGAAGCAGATTCAGAGAGG - Intergenic
1102656660 12:114487690-114487712 CTGAAGAAGAAGATGTAGAATGG + Intergenic
1102766883 12:115441065-115441087 ATGAAGAAATAGGCTTAGAGGGG + Intergenic
1103852740 12:123943797-123943819 ATGAGGAAACAGATCAAGAGAGG + Intronic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1106200454 13:27532418-27532440 ATGAAGAAACAGAATTAGCGAGG - Intergenic
1106301246 13:28468156-28468178 ATGAGGAAACTGGTTCAGAAAGG - Intronic
1107031491 13:35858417-35858439 ATGAAGAAACATGTTTAGTCAGG + Intronic
1107887741 13:44888360-44888382 ATGGAAAAGTAGATTTAGAAAGG + Intergenic
1108000784 13:45904105-45904127 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1108749233 13:53430350-53430372 ATGAAGATTCAGATTCAGTAGGG + Intergenic
1108915329 13:55603689-55603711 ATGAAGAAAGAGATGTCAAATGG - Intergenic
1109651991 13:65339256-65339278 ATGAAAGTACAGAATTAGAAAGG + Intergenic
1109829346 13:67766359-67766381 ATGCAAACACAGCTTTAGAAAGG - Intergenic
1110086036 13:71381036-71381058 ATTAAGAAACAGAATTAGCCAGG + Intergenic
1110289971 13:73794122-73794144 TTGAAGAAGCAGATTTTCAAAGG - Intronic
1110370675 13:74736902-74736924 ATGCACATACAGATTAAGAATGG - Intergenic
1110553662 13:76834640-76834662 AAAAAGAAAAAGATTTAAAAAGG + Intergenic
1110587340 13:77209593-77209615 ATTAAGAACCAAAGTTAGAATGG - Intronic
1110597391 13:77334284-77334306 AGGAAGAAGGGGATTTAGAATGG - Intergenic
1111171884 13:84537695-84537717 ATGACGAAACAGTTGGAGAAGGG - Intergenic
1111188949 13:84783027-84783049 ATGAAAAAAGAGAATTAAAAAGG - Intergenic
1111573740 13:90121911-90121933 AGGAAGAAACACAGTAAGAAGGG - Intergenic
1112044600 13:95583690-95583712 ATGAAGAAAAATATTTAATAGGG + Intronic
1112268492 13:97947552-97947574 ATGAAGCAACTCATTTAGAGAGG - Intergenic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1112670658 13:101633315-101633337 ATGATGAACTAGATTAAGAAGGG + Intronic
1113278955 13:108767417-108767439 TTTAAGAAACACATTTATAAAGG + Intronic
1113315063 13:109170553-109170575 AGGAAGAAAGAGATGGAGAAAGG + Intronic
1113322226 13:109245223-109245245 ATGAAGAAAGAAAATGAGAAGGG - Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1113757730 13:112825322-112825344 GTGAAGAAACAGAATAGGAAGGG - Intronic
1114196535 14:20482078-20482100 ATGAACAAACAAACTCAGAATGG - Intergenic
1114222610 14:20710340-20710362 ATCGGGAAACAGATTTAAAATGG - Intergenic
1114241450 14:20872019-20872041 ATGTAGAAACTTTTTTAGAATGG - Intergenic
1114489900 14:23093868-23093890 ATGCATGATCAGATTTAGAAGGG - Intronic
1114813996 14:25934489-25934511 ATGGAGAAAGAAATATAGAAAGG + Intergenic
1115101262 14:29703528-29703550 AAGAAATAACAAATTTAGAAGGG + Intronic
1115114208 14:29859944-29859966 ATGAGTAAACAGATTTTGAATGG + Intronic
1115428420 14:33288109-33288131 AAGAGGAAACTGATTTAGAAAGG + Intronic
1115706426 14:36003512-36003534 ATGAGGAAACTGACTTACAAAGG - Intergenic
1115989253 14:39135043-39135065 ATAATGACACAGATTCAGAAAGG + Intronic
1116057183 14:39877975-39877997 TTGAAGACACAGTTTAAGAATGG - Intergenic
1116089436 14:40286162-40286184 AAGAAGAGAGAGATTGAGAATGG - Intergenic
1116130385 14:40848480-40848502 ATGATGAAAGAGATATAAAAAGG + Intergenic
1116174589 14:41451021-41451043 ATGAAAGAAAAGATTTAGAAGGG + Intergenic
1116395023 14:44437518-44437540 ATTAAGAGAAAGTTTTAGAAAGG + Intergenic
1116512238 14:45760234-45760256 ATGAACAAACTGATTAAAAATGG - Intergenic
1116582621 14:46661697-46661719 ATGGAGAAACAGATTTTCATAGG - Intergenic
1117278149 14:54210236-54210258 AAGGTGAAACAGATCTAGAAAGG - Intergenic
1117878364 14:60280332-60280354 ATGGAGAAAGAGATTCGGAAAGG + Intronic
1118057384 14:62094252-62094274 CTGAAGAAAGAGATTTTAAAAGG - Intronic
1118393645 14:65317358-65317380 ATGAAGAAATGGATAGAGAATGG + Intergenic
1118403795 14:65403877-65403899 AAAAAGAAACAAATCTAGAAAGG - Intergenic
1118518173 14:66550115-66550137 ATTAAGAAATACATTTTGAAAGG + Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118668423 14:68095992-68096014 AAAAAGAAACAGACTCAGAAAGG + Intronic
1118815980 14:69314296-69314318 AAGAAGAAACATGTTCAGAAAGG + Intronic
1118918369 14:70127461-70127483 AGGAAGAAAAACAATTAGAATGG - Intronic
1119010056 14:70976247-70976269 ATGAGGAAACAGATTTACAGGGG + Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1119688029 14:76648517-76648539 ATGAAGACCCAGGTTTGGAAAGG + Intergenic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1119836781 14:77757404-77757426 ATGAGAAAACAGATTCAGAGAGG - Intronic
1119964749 14:78901861-78901883 ATGAAGCAACAGAGTAAGAAAGG - Intronic
1120011651 14:79422580-79422602 TGGTAGAAATAGATTTAGAAAGG + Intronic
1120223240 14:81759416-81759438 ATAAAGAAACAAAATTATAAAGG - Intergenic
1120716412 14:87845811-87845833 ATGGAGAGACATATTTAGATAGG + Intronic
1120766272 14:88329521-88329543 AAGAAGAAAGAGATTTAGACTGG - Intergenic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121293421 14:92795944-92795966 ATGAAGATATAGATACAGAAGGG - Intronic
1121416322 14:93781585-93781607 ATGAAGGCACAGATGTATAAGGG + Intronic
1121723657 14:96130338-96130360 ATGGGGAACCAGATTCAGAATGG + Intergenic
1122101520 14:99414140-99414162 ATGAAGAAGCAGATTTATGGCGG - Intronic
1122335108 14:100969834-100969856 ATAAATAAACAAATTTAGATGGG + Intergenic
1122739906 14:103866288-103866310 AAGAAGGAACAGCTTTAGCAGGG + Intergenic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1124928539 15:34096603-34096625 ATGAAGACATGGCTTTAGAATGG - Intronic
1125146061 15:36470011-36470033 TTGAAGAAAAAGATTGAAAAGGG - Intergenic
1125239306 15:37555305-37555327 AAAAAGAAACAAATCTAGAATGG + Intergenic
1125553309 15:40564325-40564347 ATGAAAAAACAAGTTCAGAAGGG + Intronic
1125972142 15:43920552-43920574 ATTAAGGAACACATATAGAATGG - Intronic
1126207742 15:46064558-46064580 ATGATGTAAAAGATTTAAAATGG + Intergenic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126416858 15:48426813-48426835 AAGAAAAAACAGACCTAGAAAGG - Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126669410 15:51102625-51102647 ATGAAGAAATAAATCTAGAAAGG + Intronic
1126711072 15:51456776-51456798 ATGAATAAACAGATACAAAATGG - Intronic
1126772207 15:52069706-52069728 ATGAAGAAACAGGCTTGGACTGG - Intergenic
1126835201 15:52655859-52655881 ATAAAGAAATAGATTCAGACAGG - Intronic
1126855482 15:52834826-52834848 ATCAGGGAATAGATTTAGAATGG - Intergenic
1126861261 15:52885207-52885229 AGGGAGAAACAGATTTGGAATGG - Intergenic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127235472 15:57046200-57046222 AGGAAGAAGCAGACTTAGATAGG + Intronic
1127473643 15:59312438-59312460 ATGAAGAAACAGAAGCATAAAGG + Intronic
1127477901 15:59351944-59351966 AGGAAGAAAGAGATCCAGAATGG - Intronic
1127666609 15:61153910-61153932 ATCAAGAAACAGATTTGGTAAGG + Intronic
1127742906 15:61930864-61930886 ATGGAGTAACATATTTAGAATGG - Intronic
1127873685 15:63093994-63094016 ATGAGGAAACAGACTTAAAGAGG - Intergenic
1128451707 15:67809699-67809721 ATGAGGAAACAGACTCAGACAGG - Intergenic
1128508010 15:68291643-68291665 ATGAAGAAAAAGAGCTAAAAAGG + Exonic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128773975 15:70304662-70304684 ATGTAGAAAGAGAATTATAAAGG - Intergenic
1128922819 15:71627910-71627932 AGGAAGACAAAGCTTTAGAAAGG + Intronic
1130128709 15:81117789-81117811 ATGAAGACGAAGATGTAGAAGGG - Intronic
1130264824 15:82390926-82390948 AAGAAGACACAGGATTAGAATGG - Intergenic
1130507165 15:84555969-84555991 AAGAAGACACAGGATTAGAATGG + Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131465411 15:92650979-92651001 ATGATGAAATACATTTAAAAAGG + Intronic
1132427698 15:101733163-101733185 AAGAAGACACAGGATTAGAATGG + Intergenic
1132875330 16:2134640-2134662 ATGAGGAAACAGGTTTGGAGAGG - Intronic
1133455011 16:5934406-5934428 AGAAAGTAATAGATTTAGAAAGG - Intergenic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1133962133 16:10503687-10503709 TTGAGGAAACTGATTTAGGAAGG - Intergenic
1133985432 16:10664716-10664738 ATTAGGAAACAGATTCAGAAGGG + Intronic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134175999 16:12006937-12006959 ATGAGAAAACAGATTCAGAGAGG + Intronic
1134519652 16:14912720-14912742 ATGAGGAAACAGGTTTGGAGAGG + Intronic
1134554279 16:15153515-15153537 ATGAGGAAACAGGTTTGGAGAGG - Intergenic
1134707324 16:16311376-16311398 ATGAGGAAACAGGTTTGGAGAGG + Intergenic
1134847800 16:17455245-17455267 ATGAATAAACAGCTCCAGAAAGG - Intronic
1134960217 16:18400749-18400771 ATGAGGAAACAGGTTTGGAGAGG - Intergenic
1135741479 16:24979101-24979123 AGGCAGAAATAAATTTAGAAGGG + Intronic
1135823817 16:25708421-25708443 ATGAAGAAATTGGTTCAGAATGG - Intronic
1135855272 16:26004022-26004044 ATGAACAAACAGAAGTAGAGAGG - Intronic
1136011514 16:27366542-27366564 ATGGAGAAACAGTTTTAGAGAGG + Intergenic
1136141088 16:28289109-28289131 AGGAAGAAACAGACCTAGAGAGG - Intergenic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1137491708 16:48938488-48938510 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1137950460 16:52778854-52778876 ATGACAAAACAGACTCAGAAAGG - Intergenic
1138251674 16:55506493-55506515 ATGAAGAAACAGACTTAAAGAGG - Exonic
1138454131 16:57111668-57111690 ATGAGGAGACAGGTTCAGAAAGG - Intronic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1139111008 16:63890865-63890887 GGGAAAAAATAGATTTAGAATGG - Intergenic
1139197092 16:64932203-64932225 GTGCAGAAACAAAGTTAGAAAGG - Intergenic
1139616062 16:68093085-68093107 CTGAAGTAACAGATATAAAATGG - Intronic
1140189862 16:72806164-72806186 ATACAGAAGCAGTTTTAGAAAGG - Intronic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1142575205 17:902423-902445 AGGCAGAAACAGATTTACTAGGG + Intronic
1142858618 17:2747976-2747998 ATGAGGAGACAGGCTTAGAAAGG + Intergenic
1143392379 17:6567314-6567336 ATAAGGAAACAGGCTTAGAAAGG + Intergenic
1143690952 17:8565113-8565135 ATAAAGGAACAAATTTTGAAAGG + Intronic
1143987830 17:10930377-10930399 AGGAAGAAACACGTTTGGAAAGG + Intergenic
1144010399 17:11142926-11142948 ATGAAGAGAAAGGTTTAGAATGG + Intergenic
1144022673 17:11251025-11251047 ATGAGGAAACCGATTCAGAGAGG + Intronic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1144485529 17:15661149-15661171 AGGAGGAAACAGATTCAGAGAGG - Intronic
1144930252 17:18853274-18853296 ATGAGGAAACAGGTATAGAGAGG + Intronic
1145856529 17:28164057-28164079 AAGTAGAAACATATTTAAAAGGG + Intronic
1147358041 17:39912749-39912771 ATGAAGAAACAGATTCAAAGAGG - Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1149333954 17:55615729-55615751 AGGAAAAAACAGAGTTGGAAGGG - Intergenic
1149376089 17:56045642-56045664 ATGAAGAAAGAGATTCAGAGAGG + Intergenic
1149747383 17:59112258-59112280 ATGAAGAAATGGACTTGGAAAGG - Exonic
1149747392 17:59112458-59112480 ATGTAATCACAGATTTAGAAAGG + Intronic
1149895937 17:60428363-60428385 AGGAAGAAACAGATGCAGAGAGG - Intronic
1150016998 17:61568086-61568108 AAGAAGAAACACATTTTGGAAGG + Intergenic
1150051262 17:61965641-61965663 CTGAAGAAACATATTTAAAATGG + Intronic
1150182102 17:63133607-63133629 AGGAAGAAACAGACTTGGACTGG - Intronic
1150883749 17:69061198-69061220 ATGAAAAGACCGATTGAGAAAGG - Intergenic
1151018191 17:70581496-70581518 AGGGAGGAAAAGATTTAGAAAGG - Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151209810 17:72536083-72536105 ATGAAGAAACATGTTCAGAGAGG - Intergenic
1151862499 17:76775381-76775403 ATCAAGAAAAAGATTTAGTGGGG - Intronic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153383270 18:4462009-4462031 ATGAAGAAAAAGGTTGTGAATGG - Intergenic
1154246132 18:12701510-12701532 GTGACGAAACAGATTTATAAAGG - Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1155068319 18:22288126-22288148 AGGGAGAAACAGATTTAAATGGG - Intergenic
1155401353 18:25442717-25442739 ATGTAGAAAAAAATTTAAAAAGG - Intergenic
1155689000 18:28593404-28593426 CTGAATAAACATATTTAGAGAGG - Intergenic
1156388284 18:36626301-36626323 ATGAAGATACATAAATAGAAAGG + Intronic
1156631186 18:38971229-38971251 AGGAAGGAACAGACTTAAAAAGG - Intergenic
1156735361 18:40251472-40251494 ATGTAGAAACAGCTTTACAATGG + Intergenic
1156761993 18:40603882-40603904 ATGAAAAATCAGTTCTAGAAGGG - Intergenic
1156762284 18:40607377-40607399 ATATAGAAAGAGATTTAGCAAGG - Intergenic
1156831107 18:41492115-41492137 GGGAAGAACCAGATTTAGATTGG - Intergenic
1157032215 18:43925258-43925280 ATAAAGAAACAGAGCTAAAAGGG - Intergenic
1157136227 18:45058537-45058559 ATGAAGAAACAGAGATGGAGGGG + Intronic
1157272199 18:46284430-46284452 ATGAAGAAACTGATTCAGAGAGG - Intergenic
1157651604 18:49338272-49338294 ATGAAGAAAAACATTTAAAAAGG + Intronic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157848127 18:51022815-51022837 AAGAAGAAACAGTTTTAGCCAGG - Intronic
1158488251 18:57887495-57887517 ATGAAGAAACAAGTCCAGAAAGG + Intergenic
1158619187 18:59016128-59016150 ATGAAAACACAGATCAAGAAGGG + Intergenic
1159004456 18:63000274-63000296 CTGAAGAAATAAATTTAAAAAGG + Intergenic
1159165603 18:64695079-64695101 ATGAACATAAAGATTTAAAATGG - Intergenic
1159277564 18:66240710-66240732 ATGAGGAAAAAGATTTATACTGG + Intergenic
1159570661 18:70108426-70108448 ATAAAGGAAAAGATTTAAAATGG + Intronic
1159744132 18:72210401-72210423 GTAAAAAAACAGATTTAAAAGGG - Intergenic
1159816881 18:73085349-73085371 ATGAGGAAACAGACTTAAAAAGG + Intergenic
1160314355 18:77827126-77827148 ATGAAGACAAAGATTCTGAATGG + Intergenic
1160610665 18:80082527-80082549 GAGAACAAACAGATTTAGAAAGG - Intronic
1162095858 19:8309597-8309619 AGGATGAATCAGATTCAGAAAGG - Intronic
1162757583 19:12869412-12869434 AAAAAGAAACAGGTTTAGAGAGG - Intronic
1163657953 19:18558641-18558663 TTGAAAAAACTGATTCAGAAGGG + Intronic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1164486571 19:28661102-28661124 ATGAAGAAAAAGAGTTTTAATGG - Intergenic
1164868205 19:31622632-31622654 GTGAAGAAATAGATTTACAAAGG - Intergenic
1165205706 19:34183582-34183604 AGGACAAAACAGATTTGGAAAGG + Intronic
1165448683 19:35870174-35870196 ATGAAAAGACAAATTTATAACGG + Intronic
1165799048 19:38536474-38536496 ATGAAGACATAGAGGTAGAAAGG - Intronic
1167247296 19:48381330-48381352 ATGAGGAAACAGGTTCAGAGGGG - Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168443042 19:56388337-56388359 ATGAAGAAACAAATGGTGAAAGG + Intronic
925487305 2:4349685-4349707 ATGAATAAATAGTTTTATAATGG - Intergenic
925611070 2:5703629-5703651 AGGAAGAAACAAATGCAGAAAGG - Intergenic
926110662 2:10181224-10181246 ATGAGGAAACAGGCTTAGAGTGG + Intronic
926475499 2:13315983-13316005 ACCAAGAAACAGTTTTATAAAGG - Intergenic
926554994 2:14347148-14347170 ATGAGTAAACAAATGTAGAACGG + Intergenic
926587358 2:14701868-14701890 ATGAGGAATCAGATTTGGAGAGG - Intergenic
927407131 2:22783647-22783669 GTGAAGAAGCAGAATTTGAATGG - Intergenic
928016067 2:27658300-27658322 GAGAGGAAACAGGTTTAGAAGGG + Intronic
928019273 2:27689089-27689111 ACAAAAAAACAGATGTAGAATGG - Intronic
928036948 2:27833394-27833416 ATTAAAAAAAAGATTGAGAAAGG + Intronic
928513525 2:32023452-32023474 ATGAGGAAACAGACTTGGAGAGG - Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928643858 2:33330229-33330251 ATTAACAAGCAGATTTAGCAAGG - Intronic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
929923815 2:46193153-46193175 ATATAGATACAGGTTTAGAAAGG - Intergenic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
930352057 2:50269093-50269115 ATGGGGAAACAGACTTAGACAGG + Intronic
930353169 2:50283411-50283433 AACAAGAAAGATATTTAGAAAGG - Intronic
930792864 2:55352993-55353015 ATAAAGAAACACATTTTCAAAGG + Intronic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931268918 2:60684816-60684838 CTGAAGAAACAGTTTAAAAATGG + Intergenic
931341355 2:61404210-61404232 ATGAAGAAAGAGAGGTATAAAGG + Intronic
931372801 2:61679709-61679731 ATGAACAAATAGATATAGTAAGG - Intergenic
931432518 2:62219580-62219602 ATGAAGAAAAAGATTTGCAAAGG - Intronic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
932281589 2:70497613-70497635 ATTAAGAACCAGCTGTAGAAAGG + Intronic
932626050 2:73296652-73296674 ATGAGGAAACAGATTCAAAAAGG + Intergenic
932956794 2:76360459-76360481 ATGTAGGAACAGATTTAGACTGG + Intergenic
933295713 2:80488646-80488668 AGGAAGAAACTGTATTAGAATGG - Intronic
934155131 2:89192157-89192179 ATAAAGAAGAAGAATTAGAAAGG - Intergenic
934212183 2:89990570-89990592 ATAAAGAAGAAGAATTAGAAAGG + Intergenic
934481552 2:94651798-94651820 ATGCTGAAACATATTTACAAAGG - Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935046145 2:99484900-99484922 ATAAAGAAACAGATTTAGAGAGG - Intronic
935134391 2:100286874-100286896 AGGAAGTAACAGAATTATAAAGG + Intronic
935470140 2:103449610-103449632 ATGAAAAAACTGAGTTTGAAAGG - Intergenic
935791884 2:106600036-106600058 AGAAAAAAACAGATTTAAAATGG - Intergenic
936398847 2:112150692-112150714 AGGAAGAAACTGATTCACAAGGG - Intronic
937018795 2:118632040-118632062 ATGAAAAAACAAAAATAGAAAGG + Intergenic
937522944 2:122734034-122734056 AACAAGACACAGATTTACAAAGG - Intergenic
937549181 2:123065662-123065684 ATGAGGAAACAGACCAAGAAAGG - Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937733734 2:125264327-125264349 GAGAAGAATCAGATTTAGAGAGG - Intergenic
937995908 2:127694924-127694946 AAGAAAAAACTCATTTAGAAAGG - Intergenic
938556630 2:132430518-132430540 ATAAAGAACCAGATTTATCAGGG + Intronic
938575522 2:132599593-132599615 ATGAAGTATCAGAGTTGGAAGGG - Intronic
938617647 2:133016038-133016060 ATGAACAAAAAAAATTAGAAAGG + Intronic
938665104 2:133526586-133526608 ATGAAGAAACAGAATTGCATGGG + Intronic
938681440 2:133695401-133695423 ATGAATAAACGAATTTGGAAAGG + Intergenic
939138549 2:138325215-138325237 ATGAAGAACCAGTTACAGAACGG - Intergenic
939396889 2:141642268-141642290 ATGAGGAAACAGATTCAGAGAGG - Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939562082 2:143743910-143743932 ATGAACCAATAGATTTACAAAGG + Intronic
939595381 2:144116436-144116458 ATGGAAAAACATTTTTAGAAGGG - Intronic
939673272 2:145040363-145040385 ATCAATAGAAAGATTTAGAAAGG - Intergenic
939888727 2:147710102-147710124 ATGAACAAACAGATTTATTAGGG - Intergenic
940001538 2:148971146-148971168 GGGAAGGAACAGAATTAGAAGGG + Intronic
940085805 2:149857161-149857183 ATGAAGAAACATGTTTTTAAGGG + Intergenic
940460535 2:153958502-153958524 AAGAAGAAACTCATTTAGTATGG - Intronic
940475441 2:154156595-154156617 ATTAGGAAACATACTTAGAAAGG + Intronic
940647477 2:156406794-156406816 AAGAAGAAAGAGCTTTAGGAAGG - Intergenic
940724969 2:157326637-157326659 AAAAAGAAAAAGATTTAAAAAGG - Intronic
941159928 2:162024337-162024359 AGCAGGAAACAGCTTTAGAATGG - Intronic
941473983 2:165925443-165925465 ATAAAGAAACAGCCTTAGTAAGG - Intronic
941478812 2:165980710-165980732 AAGAATAAACAGATTTAAAATGG + Intergenic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941803082 2:169682844-169682866 TTAAGGAAACAGATTCAGAAGGG - Intronic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
941936899 2:170988989-170989011 AGGAGGAAACAGATTTGGAGTGG - Intergenic
942790032 2:179750612-179750634 GTGAAGGGACAGACTTAGAAGGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943167211 2:184345027-184345049 ATGAAAAAACAAATATGGAATGG - Intergenic
943306502 2:186269140-186269162 ATGAAGAGAGAGAAGTAGAAAGG + Intergenic
943686611 2:190825156-190825178 ATTAATAAACAAATTTAGTAGGG - Intergenic
943705947 2:191034473-191034495 ATGTAGTAATAGACTTAGAAAGG + Intronic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944788284 2:203096456-203096478 AGGGAGAGACAGATTTATAAAGG - Intronic
945036330 2:205707052-205707074 ATGAAGAAAGATGTTTAGAAAGG - Intronic
945239553 2:207663674-207663696 ATGAAAAAATAAATTTACAAGGG + Intergenic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
945636665 2:212362274-212362296 ATGGAGAAATAAATTTAAAAAGG + Intronic
945775024 2:214095591-214095613 ATGAAAACACATATTCAGAAAGG - Intronic
946565004 2:220954654-220954676 ATTTAGAAATAGATTTAGAGAGG - Intergenic
946618798 2:221538839-221538861 ACGAAGAAACAAATGTAAAAAGG - Intronic
946811311 2:223528973-223528995 ATGAAAAGACAGTTTTAAAAGGG - Intergenic
946886044 2:224223979-224224001 ATGTAGAGTCAGATTAAGAAGGG + Intergenic
946978396 2:225178439-225178461 GTGAAGAAACGGAATGAGAAGGG - Intergenic
947277332 2:228407366-228407388 AAGAGGAAACAAATTCAGAAAGG + Intergenic
947297758 2:228651455-228651477 ATGAAAAAAAAGAGTTAGCATGG + Intergenic
947403677 2:229752959-229752981 ATGAAGAAAGAGGTCAAGAAAGG - Intergenic
948027686 2:234790994-234791016 ATGAAGAAAAAGATTCTGCAAGG - Intergenic
948326433 2:237125542-237125564 AGGAAGAAAGATATCTAGAAAGG + Intergenic
948721228 2:239901636-239901658 TTGAAGAAACACATTTTGTAAGG + Intronic
1168941906 20:1719967-1719989 ATGAGGACACAGGTTTAGAGAGG - Intergenic
1169459889 20:5785350-5785372 ATGAGGAAACAGTTTTAGAGAGG + Intronic
1169798754 20:9494084-9494106 ATTAAGAAGAAAATTTAGAAAGG - Intergenic
1170508430 20:17052988-17053010 ATGAAGAAAAAGATGTTTAATGG + Intergenic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1170866943 20:20165889-20165911 ATAAAGCAACAAATATAGAAAGG - Intronic
1171507393 20:25648766-25648788 AGGAGGAAGCAGATTTAGAGAGG + Intergenic
1172384226 20:34522262-34522284 ATGGGGAAACAGGTTTGGAAAGG - Intronic
1173323731 20:42013408-42013430 ATGAGAAAACAGATTCAGAGAGG - Intergenic
1173451710 20:43170251-43170273 ATGAAGTAACATATATAAAATGG - Intronic
1173684872 20:44916250-44916272 AAGAAAAAACAGATTTAAGAGGG - Intronic
1173894498 20:46540477-46540499 GAGAAGAAACAGATTCAGAGAGG - Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174127691 20:48319338-48319360 AAGGAGAGACAGATCTAGAATGG - Intergenic
1174428521 20:50450382-50450404 ATAATGAAACAGATCTAGAGTGG + Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174772125 20:53310199-53310221 ATGAAGAAACAGAAGTTGTATGG + Intronic
1174781984 20:53398136-53398158 ATGAAGAAAAAAAATTACAAAGG + Intronic
1175020131 20:55837378-55837400 ATGAAGAAACAAAATTGGAATGG - Intergenic
1175568512 20:60000236-60000258 GTGTGGAAACAGAATTAGAAAGG + Intronic
1175646488 20:60677304-60677326 ATTAAAAAACATATTTAGCACGG - Intergenic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1177279290 21:18958949-18958971 CTAAAGAAACAGATATAGACAGG - Intergenic
1177351660 21:19951151-19951173 ATAAAGCAACACATTTATAAGGG - Intergenic
1177455752 21:21335757-21335779 AAGAGGAAACAGATTTAATATGG - Intronic
1177540417 21:22485626-22485648 AAGAAGAAACACATTTATAATGG + Intergenic
1177614593 21:23500526-23500548 ATGAAGAAATTGATTTAAAAAGG + Intergenic
1177741306 21:25156859-25156881 GAGAAGAAACATATTCAGAAGGG + Intergenic
1177793511 21:25747072-25747094 ATGTAGAAACAGATTTAAAGAGG + Intronic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178884427 21:36474113-36474135 ATGAGGCAACAGTTTTAGGATGG + Intronic
1178991125 21:37357644-37357666 ATGAGGAAACAAATTCAGAGAGG + Intergenic
1179020778 21:37638823-37638845 AGGAAGATACAAATATAGAATGG - Intronic
1179805835 21:43836300-43836322 ATGGAGAAACAGATTTGGAGGGG - Intergenic
1180595512 22:16970380-16970402 ATGGAGAAACTAATTCAGAAAGG - Intronic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182787005 22:32916390-32916412 ATGAGGATACAGATCCAGAAAGG + Intronic
1183223373 22:36531786-36531808 ATGAATAAGCAGGTTTAGAGAGG - Intergenic
1183730179 22:39614158-39614180 ATGAAGAAACTGAGACAGAAGGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184074019 22:42164728-42164750 ATGGAGACAAGGATTTAGAAAGG + Intronic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
949872461 3:8600973-8600995 AGGATGAAACAGATTTGGAGAGG + Intergenic
950562302 3:13740197-13740219 ATGAAAAAACATCATTAGAAGGG - Intergenic
950711017 3:14812747-14812769 ATAAAGAAACAGGTGTAGAGAGG - Intergenic
950982973 3:17328934-17328956 ATGAGGAAATAGTTTTAAAAAGG + Intronic
950993460 3:17467176-17467198 ATGAAGGATCAGACCTAGAATGG - Intronic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951096709 3:18640614-18640636 TTGAAGAAACACATTTTGTAGGG - Intergenic
951252039 3:20405082-20405104 GTGAATAAACAGATATAGAATGG - Intergenic
951276459 3:20692363-20692385 AGGAAGAAACAAATTTTAAAAGG + Intergenic
951359549 3:21708802-21708824 TTAATTAAACAGATTTAGAAAGG - Intronic
951717154 3:25662191-25662213 ATAAAAAAACAGGCTTAGAAAGG + Intronic
952225383 3:31370137-31370159 ATGGAGAAACAGATTTTCAGAGG - Intergenic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
952540338 3:34360725-34360747 ATGGAAAAACAAATTTATAATGG - Intergenic
952706952 3:36388327-36388349 ATGAAAAAACAGTATTAAAATGG - Intronic
953039016 3:39238257-39238279 AGGAAGAAGGAGATTGAGAAAGG - Intergenic
953367874 3:42362322-42362344 AAGAAACAATAGATTTAGAAAGG + Intergenic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
953688894 3:45100622-45100644 AGGAAGAAAGAGAAATAGAAAGG - Intronic
954274687 3:49534508-49534530 ATTAAAAAAAAGATTTAAAATGG + Exonic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
954604618 3:51899345-51899367 ATGAAAAAAAAGTTTTAAAAGGG + Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955276035 3:57548021-57548043 ACGAACAACAAGATTTAGAATGG + Intergenic
955830571 3:62997970-62997992 ATGAAGAAAAATGATTAGAATGG + Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956184165 3:66546762-66546784 AGAAAGAAACATATTTTGAAAGG + Intergenic
956190689 3:66605187-66605209 ATGAAAAAACAGACATAGAGAGG - Intergenic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956881584 3:73516525-73516547 ATGTAGAAACACGTTAAGAAAGG + Intronic
956947655 3:74241461-74241483 AAGAAGAAATACATTAAGAAGGG - Intergenic
957264927 3:77950761-77950783 ATGAAGAAAAAGCATCAGAAAGG - Intergenic
957368364 3:79256597-79256619 ATGAATTCACAAATTTAGAATGG - Intronic
957513372 3:81218929-81218951 ATGCAGAGACAGGTTTTGAAAGG + Intergenic
957567625 3:81905193-81905215 ATAAAGAAATACATTAAGAAAGG - Intergenic
957720885 3:83997850-83997872 ATGAAGAAAATAATTTAAAAAGG + Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
957879685 3:86195723-86195745 ATAAAAAGAGAGATTTAGAATGG + Intergenic
957924403 3:86790080-86790102 ATGAAGAAAGAGATTTATTGTGG - Intergenic
957940565 3:86997554-86997576 ATAAAGAAACAGATGCAGACAGG - Intergenic
958115221 3:89207687-89207709 ATGTAGGAACACATTTATAATGG + Intronic
958155109 3:89747226-89747248 ATTCAGAGACAGATTTACAAAGG + Intergenic
958538925 3:95443598-95443620 ATGTACAAACATATTTTGAAAGG - Intergenic
958648116 3:96899267-96899289 ATGAAGACACAGATATACATAGG - Intronic
958729273 3:97943718-97943740 ATAAAGAAACAGATTTCTATAGG + Exonic
958780089 3:98530486-98530508 ATGAAAAAACAACTTAAGAAAGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
958960925 3:100509017-100509039 ATGAAGAGACAAACTTCGAATGG + Intronic
959126469 3:102295378-102295400 ATCATCAAACAGATTAAGAATGG + Intronic
959392442 3:105792887-105792909 AGGAGGAAACAAATTTAAAAAGG + Intronic
959552567 3:107679687-107679709 ATGAACAAACAGAACCAGAAAGG + Intronic
959575258 3:107926835-107926857 ATGAAGTAACAAATATAAAACGG + Intergenic
959670097 3:108967271-108967293 ATTTAGAAACAGATATAAAACGG + Intronic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
959793260 3:110390602-110390624 AAGAAGAAACAGATTATGAAGGG - Intergenic
959794528 3:110408913-110408935 ATGAATAAACAAATTCAGCAAGG - Intergenic
959861303 3:111218159-111218181 GTGAGGAAACAGATTCAGAGAGG + Intronic
960309317 3:116100850-116100872 AGGAAAAACCAGATCTAGAAAGG - Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960652444 3:119966432-119966454 AAGAAGAAACAAATTTAGAGAGG + Intronic
960675133 3:120186226-120186248 ATTAGGAAACAGACTTAGAGAGG + Intronic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961385106 3:126518738-126518760 ATGAAGAAACAGGTGGAGAGAGG + Intergenic
961547119 3:127642382-127642404 ATGAAGCAGCAGATTTATGAAGG + Intronic
961687740 3:128646359-128646381 GTGAAGAAACAGTTTTAGGCTGG - Intronic
961933537 3:130558987-130559009 ATGAGGAAACAGACTTTTAAGGG - Intergenic
961983873 3:131111648-131111670 ATGAGGAAACAGGTTCAGAGAGG - Intronic
962098070 3:132312918-132312940 AAGAAAAAAAAGATTTACAATGG - Intergenic
962137266 3:132747906-132747928 ATAAAGAAAAAAATTTAAAAAGG - Intergenic
962298711 3:134217450-134217472 ATTAAGACCCAGATTTGGAAAGG - Intronic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963439915 3:145326156-145326178 TCAAAGAAACAGAGTTAGAAAGG - Intergenic
963728452 3:148947673-148947695 ATGAAGAAACAGAGAAGGAAAGG + Intergenic
963889912 3:150622707-150622729 ATGAAAACACATCTTTAGAAGGG - Intronic
964447364 3:156773978-156774000 ATGAGGAAACAGGTCTAGAAAGG + Intergenic
964450548 3:156808625-156808647 ATGAAGAAACAAATTCAGACAGG - Intergenic
964514009 3:157486611-157486633 ATGAGGAAACAGACATAGAAAGG - Intronic
964575375 3:158160901-158160923 ATGAAGAAACAGACTTACAGAGG + Intronic
964592366 3:158378893-158378915 GTGAATAAACAGATTTTGGAGGG - Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
964839807 3:160981380-160981402 ATGAAGAAACCCATGTAGACAGG - Intronic
964861697 3:161209533-161209555 ATGAAGAAACCTAATTAGTATGG - Intronic
965022137 3:163244539-163244561 ATGATGAATAAGATCTAGAAAGG + Intergenic
965233209 3:166080559-166080581 ATGAATATAAAGTTTTAGAATGG - Intergenic
965246874 3:166283707-166283729 ATGAAAAAATAGATTTCAAAAGG + Intergenic
965259365 3:166460589-166460611 ATGAAGAAACACAAGTAGACAGG - Intergenic
965357636 3:167696000-167696022 AAAAAAAAACAGATTTAAAAGGG + Intronic
966113444 3:176431909-176431931 AATAAGAAAAAGATTTTGAAAGG + Intergenic
966299807 3:178465393-178465415 ATGAGGAAACATAATTAGAAAGG - Intronic
966316573 3:178653399-178653421 ATAAAGAATAAGAATTAGAAGGG - Intronic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966406288 3:179601866-179601888 ATAAAGAAACAGGTTTAGACAGG - Intronic
966430365 3:179825738-179825760 ATGAAGAAACTGAGTTAAAGAGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966706002 3:182914651-182914673 TTCAAGAAACAGATTTAGGAGGG - Intronic
967199632 3:187060546-187060568 ATGAAGACACATAGTTAGGAAGG + Intronic
967299509 3:187998856-187998878 AGGAAGAAAAAAATTTACAATGG + Intergenic
967661385 3:192114639-192114661 TTCAAGAAACAGATTTTGTAAGG - Intergenic
967993861 3:195152199-195152221 ATGAGGAAACAAATTCAAAATGG + Intronic
968531541 4:1094455-1094477 AGGAAGAAACAGGTAGAGAATGG + Intronic
969304936 4:6320170-6320192 ATGAGGAAACTGATTCAGAGAGG - Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970672760 4:18415320-18415342 ATGAGGAAACAGATTCAGTGAGG - Intergenic
970751021 4:19361527-19361549 ATAAAGAAAGAGATATGGAATGG - Intergenic
970945010 4:21681060-21681082 ATAAAGAAAAAGATTTATATTGG - Intronic
971021435 4:22540447-22540469 ATGAATAAACAGCCTTAGAGAGG + Intergenic
971056410 4:22918104-22918126 ATGTCGAAACACATTTAAAAAGG + Intergenic
971132583 4:23829324-23829346 ATGATGAAATAGATTATGAATGG - Intronic
971199244 4:24497019-24497041 AGGAAGAAATAGGTTTAAAAAGG + Intergenic
971700923 4:29974238-29974260 ATGAAGACACAGTGTAAGAAAGG - Intergenic
971901596 4:32666282-32666304 ATGAACATATAGATTTAAAATGG - Intergenic
971927341 4:33029912-33029934 ATTCAGGCACAGATTTAGAATGG - Intergenic
971976261 4:33692122-33692144 ATGAAGAAAATGATTTTTAATGG + Intergenic
972560038 4:40218766-40218788 ATGAAAAAACAGGTTTGGAGTGG + Intronic
973099049 4:46239637-46239659 AAGAAGAAACAGAACTGGAATGG - Intergenic
973292767 4:48485744-48485766 AAAAAGAAACACATTTAGTAAGG - Intronic
973876299 4:55223093-55223115 ATGAGGAAACAGGTTCAGAGAGG - Intergenic
974276863 4:59732138-59732160 TTGAAGAAAGATATTTTGAATGG - Intergenic
974754706 4:66187891-66187913 AGTAAGAAACACAGTTAGAAAGG + Intergenic
975765387 4:77662227-77662249 ATGAAGAAACAGGATTCGCAAGG - Intergenic
975890243 4:79018864-79018886 ATGAAGAGGAAGATTTTGAAAGG + Intergenic
975969998 4:80022029-80022051 ATGAAGAAACAAGCTTATAAAGG + Intronic
976120649 4:81777462-81777484 AGAAAGAAACAGAATCAGAAAGG + Intronic
976496427 4:85735022-85735044 ATGAAGAACTGGATTTAGGAAGG - Intronic
976757161 4:88510852-88510874 ATGAAGACACAATTTTAAAATGG + Intergenic
976785407 4:88814152-88814174 AAGAAGAACAAGTTTTAGAAAGG + Intronic
977064158 4:92292642-92292664 ATGAATAAATATGTTTAGAATGG - Intergenic
978067036 4:104417708-104417730 ATGAAGAAACAGATTCAAAGAGG + Intergenic
978270819 4:106887910-106887932 ACACAGAAACAGTTTTAGAAAGG + Intergenic
978404996 4:108369981-108370003 ATGCAGAAACACATTTAATAGGG - Intergenic
979119658 4:116881755-116881777 ATGGAAAAACACATTTAAAATGG + Intergenic
979224410 4:118267617-118267639 ATGAGGAAACAGGTTTGGAATGG + Intergenic
979916245 4:126437654-126437676 AAGAAGAAACAGAGTGAAAAGGG - Intergenic
980116094 4:128680324-128680346 ATGAAGTAACAGATATAGTTAGG + Intergenic
980147034 4:128999600-128999622 CTGAAGAAACTGTTTTAGAGGGG - Intronic
980204264 4:129697556-129697578 AGGAAGAAAAAGATTCAGGAAGG - Intergenic
980604528 4:135072032-135072054 GAGAAGAAAAAGATATAGAAAGG - Intergenic
980728349 4:136795047-136795069 CTGAATAATCAGATATAGAAGGG + Intergenic
980862544 4:138516990-138517012 ATGAGGAAACAGATACAGAGAGG - Intergenic
980879732 4:138697625-138697647 AAGAAGAGAGAGATGTAGAAAGG - Intergenic
981058714 4:140395945-140395967 ATGAAGACACGGATGGAGAATGG - Exonic
981068167 4:140507245-140507267 AGGGAGAAACAGATTTAAAAAGG - Intergenic
981101701 4:140836144-140836166 GTGAAGAAAAACATTTAAAAGGG - Intergenic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
981446383 4:144843265-144843287 ATGAAGAAAAACAGTAAGAAAGG + Intergenic
981642522 4:146961311-146961333 AAGTAGAAACCGATTTACAATGG - Intergenic
981665193 4:147216224-147216246 AAGAAGAAACATATTTTTAAAGG - Intergenic
982246060 4:153352456-153352478 ATGAAGAAACAGACATAGAGAGG - Intronic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
982510148 4:156272362-156272384 ATGAACAAACACATTTCAAAAGG - Intergenic
982799409 4:159685424-159685446 ATGAAGGAAGAAATTTAGAGGGG + Intergenic
982823259 4:159970872-159970894 AAGAAGAAATAGATTTAAAAAGG - Intergenic
983187047 4:164712072-164712094 ATGATTTAACAGATTTAAAAAGG + Intergenic
983325330 4:166248038-166248060 ATGAAGAGATGGATGTAGAATGG + Intergenic
983446094 4:167854889-167854911 ATAAAGAAACAGGTTTACAGAGG + Intergenic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
983710821 4:170713490-170713512 ATAAACAAATAGATTTAGATGGG - Intergenic
983773717 4:171580700-171580722 ATGGACAAACAGATTAAGATTGG - Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984111911 4:175627400-175627422 ATGAGCAAGGAGATTTAGAAAGG + Intergenic
984238479 4:177190439-177190461 ATTAAAACAAAGATTTAGAATGG + Intergenic
984338416 4:178421877-178421899 TTAAAGAAACAGATATATAAAGG + Intergenic
984502673 4:180576340-180576362 ATGAAGAAACAAACTTAGAGAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985008990 4:185563019-185563041 ATGAAGAAAAATATTTAGCAAGG + Intergenic
985340091 4:188941622-188941644 ATGAAGAAACAAATTTAGAGAGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986067282 5:4246934-4246956 AAAAAGAAATACATTTAGAATGG - Intergenic
986199230 5:5566485-5566507 ATGAAGAAACGGCATCAGAAAGG + Intergenic
986249244 5:6041385-6041407 ATGAATAAAAATATTTTGAAAGG + Intergenic
986539306 5:8827357-8827379 CTGAAGAAAGAGTATTAGAATGG + Intergenic
986832657 5:11598124-11598146 ATGAGGAAACAGATTCAGAGAGG + Intronic
986837511 5:11656050-11656072 ATCCTGAAACAGATTTGGAATGG - Intronic
987040841 5:14060879-14060901 GGGAAGAGACAGATTCAGAAGGG + Intergenic
987064690 5:14277827-14277849 ATGAAGAAAAAATCTTAGAAAGG - Intronic
987083897 5:14450852-14450874 TTGAAACACCAGATTTAGAATGG - Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
987300644 5:16594923-16594945 ATGAAGAAAGAGATGAAGTAAGG + Intronic
987346924 5:16987064-16987086 AGCAAGAAACTGATTTAAAAAGG + Intergenic
987543566 5:19285076-19285098 ATAAAGAAACAAATTTAAAGTGG + Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987695656 5:21326743-21326765 ATGAAGATGCAGATTTAACAGGG - Intergenic
987782379 5:22455845-22455867 GTGAAGAAAGAGATTTTAAAAGG + Intronic
988371883 5:30380501-30380523 ATGAAGAAGCCGATCTAGATTGG + Intergenic
988425451 5:31058380-31058402 AAGAAGAAGCAGAGTTATAATGG + Intergenic
988490895 5:31704477-31704499 TTAAAGAAACACATTTTGAAGGG - Intronic
988501032 5:31783967-31783989 ATGAGGGAACAGATTGAGAGGGG - Intronic
988562973 5:32297498-32297520 GTGAAGAAAAGGATTTAGAATGG - Intronic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
988699268 5:33657043-33657065 ATGAGGAAACAGGTATAGAGTGG + Intronic
989529630 5:42492696-42492718 TTGGAGAAATAGATTTGGAATGG + Intronic
989550855 5:42734618-42734640 ATGAAGAAACAGATATTGAGAGG + Intergenic
989611611 5:43298964-43298986 ATGGTGAAAGAGCTTTAGAAAGG + Exonic
989668405 5:43884730-43884752 ATCAAAAAACAGATTTAAATTGG - Intergenic
990436749 5:55800198-55800220 ATGAAGAAACAAATATAGAGAGG + Intronic
990633211 5:57693492-57693514 AAGAAGGAAAATATTTAGAATGG + Intergenic
990655741 5:57953148-57953170 ATGAATAAACTCATTTAAAATGG + Intergenic
990810733 5:59720049-59720071 TGGAAGAAACAGCTTCAGAAGGG - Intronic
991402357 5:66265574-66265596 ATGAAAAAAAAGATATAAAAAGG - Intergenic
991489775 5:67171268-67171290 AAGAAGATACACATGTAGAAAGG - Intergenic
991744746 5:69725352-69725374 ATGAAGATGCAGATTTAATAGGG + Intergenic
991752959 5:69829875-69829897 ATGAAGATGCAGATTTAATAGGG - Intergenic
991796316 5:70305082-70305104 ATGAAGATGCAGATTTAATAGGG + Intergenic
991802577 5:70386608-70386630 ATGAAGATGCAGATTTAATAGGG - Intergenic
991824126 5:70600666-70600688 ATGAAGATGCAGATTTAATAGGG + Intergenic
991832278 5:70705000-70705022 ATGAAGATGCAGATTTAATAGGG - Intergenic
991888694 5:71304636-71304658 ATGAAGATGCAGATTTAATAGGG + Intergenic
992410453 5:76500254-76500276 ATGCAGATACTGATTTAGAGTGG + Intronic
992422214 5:76617916-76617938 ATGAAGTAATAGAGTTGGAAGGG + Exonic
992604705 5:78443310-78443332 ATAAGCAAACAGATTTAGAGAGG - Intronic
992890971 5:81203694-81203716 ATGAGGAAACAGGTTTGGACCGG - Intronic
993111081 5:83658012-83658034 ATGATGAAAAAGTTTTGGAAAGG - Intronic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993198017 5:84775364-84775386 ATGAAGAAACAAGTTTAGAATGG + Intergenic
993491151 5:88551689-88551711 ATGAAGAAACAAATACAAAAGGG - Intergenic
993535281 5:89076661-89076683 CTGAGAAAACAGATTTAGAGAGG + Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
994154192 5:96484393-96484415 ATTTAAAAACAGATGTAGAAGGG - Intergenic
994410308 5:99399852-99399874 ATGAAGAAACAGAAATAGCTTGG - Intergenic
994483512 5:100365424-100365446 ATGAAGAAACAGAAATAGCTTGG + Intergenic
994582190 5:101658391-101658413 ATGAAAAAGCAGATATAAAAGGG + Intergenic
995207397 5:109497009-109497031 ATGAAGAAACTGAGCTAAAAAGG - Intergenic
995597183 5:113760385-113760407 AAGAAGCAAGAGAATTAGAATGG + Intergenic
995767137 5:115630871-115630893 ATTAAGAAACTGTATTAGAAAGG - Intronic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
996171421 5:120296366-120296388 ATGAGGAAATAGATTTAGAGAGG - Intergenic
996861665 5:128073966-128073988 AAGAAGAAACAGATGCAGAAAGG + Intergenic
997235307 5:132269072-132269094 ATAAAGAAACAGGTTCAGAGAGG + Intronic
997276034 5:132591297-132591319 ATGAAAAAGCAGACTTAGACAGG + Exonic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997701986 5:135908935-135908957 ATGAGGAAACAGAGGTAGAGAGG + Intergenic
998555135 5:143115775-143115797 GTGAGGAAACAGGTTTAGAGAGG + Intronic
998753089 5:145346117-145346139 ATGAATAAACAGAATTTCAAAGG - Intergenic
998762554 5:145448719-145448741 ATGAGATAACAGATTTAGAGTGG - Intergenic
998774038 5:145578863-145578885 ATGAGTAAACAGAGTTAGAAGGG + Intronic
998800125 5:145860761-145860783 ATAAAGAAACAGATTGGGAGAGG - Intronic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999551504 5:152692331-152692353 ATGAAACAACAGATTTTAAATGG - Intergenic
999921392 5:156325482-156325504 ATGAGGAAACAGATCGAGAGAGG + Intronic
1000629460 5:163575189-163575211 ACAAAGAAAAAGAATTAGAAAGG - Intergenic
1000778140 5:165444517-165444539 CTGGAGAAACTAATTTAGAAAGG - Intergenic
1000930879 5:167249811-167249833 ATAGAGAAACACATTTAGAGAGG - Intergenic
1001145883 5:169184258-169184280 ATGCAGAAACACATCTTGAATGG - Intronic
1001176018 5:169469669-169469691 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1001492108 5:172163246-172163268 ATGAGGAAAAAGATTCAGAGAGG + Intronic
1002033996 5:176451581-176451603 ATGAAGAAACAGGTTCTGAGAGG + Intronic
1002122868 5:177019242-177019264 ATAAAGAAACAGACTAGGAAAGG - Intronic
1002967903 6:1985600-1985622 ATGAAACAACAGATTTGAAAAGG + Intronic
1003077693 6:2997848-2997870 ATGAAGAAGCAGTTTTCCAAAGG + Intronic
1003337585 6:5188645-5188667 ATGAGGAAACAAGTTTAGAGAGG - Intronic
1003723554 6:8733488-8733510 TTCAAGCATCAGATTTAGAAGGG + Intergenic
1003959930 6:11199372-11199394 ATGAGAAAACAGGCTTAGAATGG - Intronic
1004098998 6:12589354-12589376 ATGAGTAAAAAGACTTAGAAAGG + Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1004875842 6:19953275-19953297 ATAAATCATCAGATTTAGAAAGG - Intergenic
1005010331 6:21329620-21329642 AACAACAAACAGATTAAGAAGGG - Intergenic
1005018963 6:21399721-21399743 GTGAGGAAAAAGATTTGGAATGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005555126 6:26971326-26971348 ATGAAGATGCAGATTTAATAGGG + Intergenic
1005815788 6:29551588-29551610 ATTAAGAAACAGGTTTTTAAGGG - Intergenic
1005966363 6:30729503-30729525 ATGAGGAAACAGGTATAGAGAGG + Intronic
1006099578 6:31678087-31678109 ATGAGGAAACAGGTGCAGAAAGG - Intronic
1006479193 6:34278228-34278250 ATGATGGATCAGCTTTAGAATGG + Intergenic
1006836917 6:37004610-37004632 AGGAAGAAACAGAATCAGAGAGG - Intergenic
1007212762 6:40208921-40208943 AAGGAGAAGCAGATTTAGATGGG - Intergenic
1007303604 6:40887366-40887388 ATGAGGAAACAGACTTTGAGAGG - Intergenic
1007428679 6:41763778-41763800 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1007643779 6:43364860-43364882 AGGCTGAAACAGATTCAGAAAGG - Intronic
1007670920 6:43552961-43552983 AAGAGGAAACAGATTTAGAGAGG - Intronic
1008150092 6:47939650-47939672 ATGAGGAAACAGATACACAAAGG - Intronic
1008601868 6:53104268-53104290 ATGTAAAAACAGAATTAAAATGG - Intergenic
1008702280 6:54115484-54115506 ATGAAGAAACAAATTACGGAAGG + Intronic
1009195858 6:60683645-60683667 ATGAGGAAACAGCTTTGGAGGGG - Intergenic
1009329983 6:62406505-62406527 ATGAGGAAAGAGATTAAGAAAGG - Intergenic
1009891631 6:69691363-69691385 AAGAAGAAAAAACTTTAGAAAGG - Intronic
1009900494 6:69803010-69803032 AGGAAGACACAGAATTTGAAGGG + Intergenic
1011491200 6:87894917-87894939 ATCAAGAAAAACATGTAGAAAGG + Intergenic
1011813979 6:91166723-91166745 ATGAGGAGACAGATGTAAAAAGG - Intergenic
1012347342 6:98207151-98207173 ATGAGAAAACAGGTTCAGAATGG + Intergenic
1012556765 6:100522783-100522805 ATGAAGACACTGGTTTACAAAGG + Intronic
1012911845 6:105126697-105126719 ATGAGGAAACAAATTTACAAAGG + Intronic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013364438 6:109425173-109425195 ATTAAGAAACTGATTCAGAGAGG + Intronic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013570883 6:111424371-111424393 ATGGAGGAACAGATATTGAAAGG - Intronic
1013637466 6:112042798-112042820 ATGAAGAAAGATATTTCCAATGG + Intergenic
1013805329 6:113990139-113990161 ATAAAGAAAAAGATTTTTAATGG + Intronic
1013905198 6:115208424-115208446 ATGAAGAACCAAATTTAAAATGG + Intergenic
1014228930 6:118880465-118880487 GCTAAGAGACAGATTTAGAAGGG - Intronic
1014533099 6:122583738-122583760 ATGAATAAACTAATCTAGAATGG - Intronic
1014755265 6:125295963-125295985 TAGAAGAAACAAATTTAGAAAGG - Intronic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015934322 6:138393185-138393207 ATGAAGAAAGAGATTTGGTGAGG + Intergenic
1015954743 6:138587974-138587996 ATGAGGAAACAGAACCAGAAAGG + Intronic
1016473528 6:144401183-144401205 ATGAATAAAAAAATATAGAAAGG - Intronic
1017136227 6:151150005-151150027 ATGATAAAACAGATTCAGAAAGG + Intergenic
1017501201 6:155024890-155024912 ATGAAGTGACAGATCCAGAAGGG + Intronic
1018097659 6:160405804-160405826 ATGAAGAAACTGATCTGGAAAGG + Intronic
1018098304 6:160412880-160412902 TAGAAGAAACAAATATAGAAGGG + Intronic
1018162480 6:161059432-161059454 ATGAAGAGAAAGATTTAGGTCGG - Intronic
1018310077 6:162499396-162499418 ATAAAGAAACAGATTTGAAGAGG - Intronic
1018633399 6:165839952-165839974 ATGAAGACAGAGATGTAGATGGG - Intronic
1019168286 6:170113705-170113727 ATGAAGATACAGATACAGATAGG + Intergenic
1019845331 7:3493808-3493830 ATGTAGAGACAGATTCAGACTGG - Intronic
1020763622 7:12295451-12295473 AAGAAGAAACAAATTTTAAAAGG - Intergenic
1022053701 7:26707016-26707038 ATGAAGGAAGAGATTTTAAATGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1023040519 7:36168821-36168843 ATGAAGAGACAGATTTAACTGGG + Intronic
1023115789 7:36860956-36860978 TTGCATAAACAGCTTTAGAAAGG - Intronic
1024367685 7:48540293-48540315 ATGATGAAATAGAATTACAAAGG - Intronic
1024484268 7:49899037-49899059 ACCAAGAAACAGATTTTCAAAGG + Intronic
1025246147 7:57319063-57319085 ATAAGGAAACAGATTTAGAGTGG - Intergenic
1026100424 7:67379538-67379560 ATGGAGCAACAGAGATAGAAGGG + Intergenic
1026169348 7:67940078-67940100 ATAAAGAAAAAAATTTATAAAGG - Intergenic
1026544413 7:71309345-71309367 AGGAAGAAGCAAATTTAGCAGGG - Intronic
1027309235 7:76936854-76936876 TTGCAGAAAAACATTTAGAAAGG + Intergenic
1027469882 7:78560208-78560230 ATCAGCAAACAGATTTAGATGGG + Intronic
1027635016 7:80660775-80660797 ATCCAGATCCAGATTTAGAATGG - Intronic
1028098964 7:86797045-86797067 ATAAAGAAAAAGATGTTGAATGG - Intronic
1028102353 7:86836832-86836854 ATTAGGAAACAGAGTCAGAAAGG + Intronic
1028175086 7:87646806-87646828 AAGAGAAAACAGATTTAAAAGGG - Intronic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028390262 7:90308147-90308169 ATGAATAAGCAGGTTCAGAATGG - Intronic
1028654171 7:93183943-93183965 GTGAAGCAACAGGTTTAAAAGGG - Intergenic
1028770449 7:94614482-94614504 ATGGAGAAAGAGATCCAGAAGGG - Intronic
1028874604 7:95806979-95807001 AAGAGGAAACAGGTTTAGAGAGG - Intronic
1029043167 7:97598778-97598800 ATGAGGAAACAGACTTACAGAGG - Intergenic
1029915179 7:104201413-104201435 ATGAAGGGACAGTTTTATAATGG - Intronic
1030330208 7:108262448-108262470 AGGAGGACACAGATTTAGAGAGG + Intronic
1030359200 7:108577852-108577874 AAAAAGAAACATATTTAGCAAGG - Intergenic
1030379281 7:108793927-108793949 TTTAAGAAACAGAGTAAGAAAGG - Intergenic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1031341374 7:120606146-120606168 ATAAAGAAAAAGATGTTGAATGG - Intronic
1031550397 7:123104651-123104673 CTGAAGAAAGAGTTTTAGCAAGG + Intergenic
1031587972 7:123555571-123555593 AGGAAGAAATATATTTAGAAGGG + Intronic
1031684769 7:124719847-124719869 TTTAAGAAACAGATTTGGATAGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1031961557 7:127994692-127994714 AAGAAAAAACAGAGTTAGCATGG - Intronic
1032392508 7:131565146-131565168 ATAAAGAAAGAGATTTAGCCTGG + Intergenic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033440089 7:141370630-141370652 AGGAAGAAAGAGATTTGGACAGG + Intronic
1033815893 7:145072441-145072463 ATAAAGAAACAAAAATAGAATGG - Intergenic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1033951872 7:146794669-146794691 ATGAAAAAACACAGTTAGATAGG - Intronic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1034695596 7:153050355-153050377 CTGAAGAAACAGATATAAATTGG + Intergenic
1034870737 7:154681283-154681305 AGGAATAATCAAATTTAGAAGGG + Intronic
1035165865 7:156989442-156989464 AAGAAGAAAAACATTGAGAATGG + Intergenic
1035356924 7:158281523-158281545 ATGAAGACACAGATCCAGACTGG + Intronic
1035906662 8:3518238-3518260 TTGAAGAAACATATTTATGAAGG - Intronic
1036092174 8:5678700-5678722 GTGAATAAACAGATGTAGACAGG + Intergenic
1036433651 8:8712879-8712901 GTAAAGAAAAAGATTTGGAACGG - Intergenic
1036775500 8:11609082-11609104 AAGAGGAAACAGACTTAGATGGG + Intergenic
1036776574 8:11617101-11617123 ATGAACAAACAGAATCAGAGAGG + Intergenic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1037453656 8:19041890-19041912 ATGAAGGAACATATTTGAAAAGG + Intronic
1037895185 8:22647387-22647409 ATGAGGAAGCAGATCCAGAAAGG + Intronic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1038592282 8:28850651-28850673 ATGAAAAAACAGATGCAGAGAGG + Intronic
1038680157 8:29659367-29659389 ATGTAGAAACAGAGATACAAAGG + Intergenic
1038777121 8:30541207-30541229 ATGAGGAAACAGATGCAGAAAGG - Intronic
1038848874 8:31255040-31255062 AGGAAGACACAGTTTGAGAAAGG - Intergenic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039186321 8:34920984-34921006 AATAAAAATCAGATTTAGAAAGG + Intergenic
1039405677 8:37310343-37310365 ATGAAGAAACAAATTCCAAAAGG + Intergenic
1039599826 8:38826625-38826647 ATGGAAATACAGATTTAGAGAGG + Intronic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1040657098 8:49523389-49523411 ATCAAGCAACAAATTTAGGAAGG - Intergenic
1040791622 8:51237207-51237229 GAGAAGAAATATATTTAGAAGGG - Intergenic
1041166397 8:55096833-55096855 AAGAAGCAGCAGATTTTGAAGGG + Intergenic
1041356744 8:57008484-57008506 TTGAAGAAACAGCTTCAAAATGG - Intergenic
1041554625 8:59139111-59139133 ATTAAGAAACAGTTTTATTAAGG - Intergenic
1041768659 8:61448778-61448800 ATGAAAAAGTAGTTTTAGAAAGG - Intronic
1041993639 8:64026314-64026336 AAGAAGAAAAAGATGAAGAAAGG - Intergenic
1042882272 8:73506842-73506864 ATGACAAAAAGGATTTAGAATGG - Intronic
1043186197 8:77153410-77153432 ATGGAGTAACTGATTTGGAATGG + Intergenic
1043655386 8:82658819-82658841 ATGAAGAAAAAGAGGGAGAATGG - Intergenic
1043766943 8:84147509-84147531 ATTCAGAAACAGATTTAAAGAGG + Intergenic
1044106269 8:88210978-88211000 ATGAGGAAACAAGTTGAGAAGGG + Intronic
1044288720 8:90441928-90441950 AAGAAGGAACAGAAGTAGAAGGG + Intergenic
1044553964 8:93542088-93542110 ATGAAGAAACAGAGGTACAGAGG + Intergenic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1045005393 8:97912905-97912927 AGGAAGAAAAAGATTTAACACGG + Intronic
1045334034 8:101182275-101182297 ATGATGAAACAGATTTGGACAGG + Intronic
1045359182 8:101416223-101416245 ATGAGGAAACTGAGTTAGATAGG - Intergenic
1045845343 8:106628411-106628433 ATGAAGAAACAGATTTTGAGAGG + Intronic
1045980119 8:108175226-108175248 ATGTAAACAAAGATTTAGAAAGG - Intergenic
1046090739 8:109500296-109500318 AGGAAGACAGAAATTTAGAAAGG - Intronic
1046106277 8:109670882-109670904 AGGTAGAAATAGAGTTAGAATGG + Intronic
1046573741 8:115999286-115999308 GTGAAGAAAGAAATTTACAAAGG - Intergenic
1046955043 8:120054057-120054079 ATGAAGATACAGGTGTGGAATGG + Intergenic
1047274472 8:123395539-123395561 ATGAAGAAACGGATTCAAAAAGG - Intronic
1047332946 8:123908860-123908882 ATGACGAAACACATTTTGGATGG + Intronic
1047701360 8:127452502-127452524 AGGAAGAAACAGATCCAGAAAGG - Intergenic
1047729098 8:127711471-127711493 AGGAAAAATGAGATTTAGAAAGG + Intergenic
1047820976 8:128520306-128520328 ATGAAGAAAGAGTTTTAGAGAGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047996987 8:130346503-130346525 ATGATGAACTAGGTTTAGAAAGG - Intronic
1048085112 8:131169011-131169033 ATGTAGAAACAAAATTTGAAGGG - Intergenic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1048804245 8:138224870-138224892 TTGTAGAAACAGAAATAGAAAGG + Intronic
1049125714 8:140785784-140785806 ATGAAGAATTAAATTCAGAAAGG - Intronic
1049864325 8:144924043-144924065 GGGAAGAAACGGAGTTAGAAGGG + Intergenic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1050445915 9:5722547-5722569 ATAAAAAGATAGATTTAGAAAGG - Intronic
1050710899 9:8462040-8462062 ATGAAGAGACAGATTCTGCATGG - Intronic
1052417196 9:28191292-28191314 ATGATGAAACAGTTTTATACAGG - Intronic
1052519773 9:29531586-29531608 GTGAAGAAACAAATTTGGGAAGG - Intergenic
1052587403 9:30447093-30447115 AAGTAGAGACAGATTTAGATAGG - Intergenic
1052691071 9:31817590-31817612 AAGAATATACAGAGTTAGAATGG - Intergenic
1052747818 9:32458006-32458028 CTAAAGAAGCAGACTTAGAAAGG + Intronic
1052879869 9:33594927-33594949 ATGTAGAAGCAGTTTCAGAAGGG + Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1054866909 9:70012287-70012309 ATAAGGAAACAGACCTAGAAAGG + Intergenic
1055081036 9:72267733-72267755 ATCAGGAAACAGGTTCAGAAAGG + Intergenic
1055433958 9:76273435-76273457 AAGAAGAAACACCTTGAGAAGGG - Intronic
1055602243 9:77931763-77931785 ATGAAGAAGCAGGCTTAGAGAGG - Intronic
1055782639 9:79835866-79835888 AAGAAGGAAAAGATTTATAAAGG + Intergenic
1055825993 9:80325533-80325555 ATGAACAAATAGAATTAGATGGG + Intergenic
1055960311 9:81814259-81814281 AAGAAGAAAGAGTTTTCGAAAGG + Intergenic
1056902242 9:90610896-90610918 ATGTAGAAACTGATTTGAAAGGG + Exonic
1057353297 9:94317532-94317554 ATGTAGACACAGATTTACATTGG - Intergenic
1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG + Intronic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1057776127 9:98011337-98011359 ATGAAGATGAAGATGTAGAAGGG + Exonic
1057923878 9:99125107-99125129 ATACAGAAACACATTTAAAATGG - Intronic
1058038834 9:100282476-100282498 AGGAAGAAAGAGTTTCAGAAGGG + Intronic
1058570225 9:106333870-106333892 ATGAAGAAACAAATGTAGCAAGG - Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058637682 9:107052347-107052369 ATGAAGAAACAGAGGCACAATGG + Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058914143 9:109549309-109549331 ATGAAAAAACAGATTAGGAGAGG - Intergenic
1059026260 9:110635560-110635582 ATGAAGAAAAAGATTTATCAGGG - Intergenic
1059206331 9:112469782-112469804 ATGAGGAAACAGACTCAAAAAGG - Intronic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059384902 9:113956993-113957015 ATGAAGAAACTGAGTCACAAAGG + Intronic
1059521956 9:114951014-114951036 ATGAAATAACAGATTCAGAGAGG - Intergenic
1059691074 9:116686940-116686962 ATGGAAAAACAGATTCAGTAAGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059825240 9:118020799-118020821 ATGAGGAAACAGGTTCAAAATGG - Intergenic
1059834461 9:118135501-118135523 ATGAAGAAAGAGATGTTCAATGG + Intergenic
1059924974 9:119200308-119200330 ATTAATAAATAGATTTAAAAAGG + Intronic
1060000859 9:119957406-119957428 ATAAGGAAACAGATTCAGAGAGG - Intergenic
1060256937 9:122039527-122039549 ATGAGGAAACAGATTCAAACAGG + Intronic
1060339585 9:122762230-122762252 ATGAAGAAATGGACTTGGAAAGG + Intergenic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1061035208 9:128109739-128109761 ATGAAGAAGCAGATTTTGGGAGG - Intergenic
1061379246 9:130244182-130244204 ATGAGGAAACAGCTTCAGAGAGG + Intergenic
1061490702 9:130942368-130942390 ATGAGGAAACTGATTCAGAAAGG + Intergenic
1061563861 9:131424331-131424353 ATGAGGAAACAGGTCTAGAGAGG + Intronic
1061608611 9:131730720-131730742 AAGAAGAACCAGCATTAGAAAGG + Intronic
1061998548 9:134203819-134203841 AGGAAGAAACTGATTTTGTATGG - Intergenic
1185745912 X:2573304-2573326 ATGAAGAAACAGAGAAAGTAAGG - Intergenic
1185861360 X:3582524-3582546 GGGAAGAAACAGATTAACAAGGG - Intergenic
1185954816 X:4478071-4478093 AAGAAGAGACAGATGAAGAAAGG + Intergenic
1186949925 X:14613052-14613074 ATGATGAAACAAACTTAGAGAGG - Intronic
1187099468 X:16178531-16178553 AGGAAAAATCAGATTTACAAAGG - Intergenic
1187204854 X:17172080-17172102 ATGAGGAAACAGATATACAAAGG + Intergenic
1187862601 X:23696583-23696605 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1188063617 X:25630820-25630842 TTGAAAAGAAAGATTTAGAAGGG - Intergenic
1188273772 X:28176601-28176623 ATGAAGAAAAAAAGTTAAAATGG - Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1188811099 X:34655866-34655888 TTGAAGAATCAAAATTAGAAAGG + Intronic
1188891432 X:35615533-35615555 AAAAATAAACATATTTAGAAGGG - Intergenic
1188941101 X:36238372-36238394 ATAAAGAAAAAGATTTTTAATGG - Intronic
1189138996 X:38581296-38581318 ATGAAGAAAAAGATGTTTAATGG + Intronic
1189773332 X:44447617-44447639 AAGAAGAAAGAGATTAGGAATGG - Intergenic
1189869058 X:45363288-45363310 ATGAGAAAACATGTTTAGAAAGG - Intergenic
1190708157 X:53048038-53048060 ATTCATAAACTGATTTAGAATGG - Intergenic
1190735766 X:53255243-53255265 AGGAAGAAAGAGAATGAGAAAGG + Intronic
1190756996 X:53409795-53409817 ATGAGGAAACAGGTACAGAAAGG - Intronic
1190889082 X:54553522-54553544 AAGAGGAAACAAATTCAGAAAGG - Intronic
1191006245 X:55714197-55714219 AGGAAGAAACAGATAAAGAAGGG - Intergenic
1191755949 X:64592511-64592533 ATGAGAAAACAGATTTAAAGAGG + Intergenic
1191797141 X:65033767-65033789 ATAAGGAAACAGATTTAGACAGG + Intronic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1191900103 X:66032108-66032130 AAGAGGAAACAGAGTCAGAAAGG - Intronic
1192981090 X:76342586-76342608 ATTAAGAAATATATTTAGTAAGG + Intergenic
1193184544 X:78496638-78496660 ATGAATAGACAGGATTAGAAAGG + Intergenic
1193444779 X:81587456-81587478 ATGGAAAAACAGATTTGGTAAGG - Intergenic
1193550228 X:82883357-82883379 ATTAATAAACAAATTTAGTAAGG + Intergenic
1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG + Intergenic
1193824533 X:86206664-86206686 ATGAGGAAAGAGATTTAGCAAGG - Intronic
1193913451 X:87334741-87334763 GTGAAGAAACAACCTTAGAATGG - Intergenic
1193947906 X:87762036-87762058 ATGAAGAAAAAGATTTAAAAAGG - Intergenic
1194745951 X:97628394-97628416 ATAAAGAAACAGAGTTTTAATGG - Intergenic
1195318201 X:103699285-103699307 ATAAATAGACAGTTTTAGAAAGG + Intergenic
1195402764 X:104479329-104479351 ATGAATAAACAGAATTAGATTGG - Intergenic
1195679548 X:107534073-107534095 ATGATGAAACAGGTCCAGAATGG - Intronic
1196023016 X:111010099-111010121 AGGAAGAAACAGTTTCAGATGGG - Intronic
1196032889 X:111110276-111110298 ATGAAGAAATAGCTTCAGAGGGG + Intronic
1196060230 X:111400324-111400346 ATGAAGAACCTGATTTGGAGGGG + Intronic
1196410686 X:115414962-115414984 ATGATGAAACAGAATTGGGAAGG - Intergenic
1196889299 X:120276787-120276809 ATGCAGACACATATTTTGAAGGG - Intronic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197084769 X:122458909-122458931 ATGAAGACACAAATAAAGAAAGG + Intergenic
1197233585 X:124033084-124033106 ATTAATAAACGGATTTAAAAAGG - Intronic
1197380991 X:125738225-125738247 ATGAGGAAACAGGTCTAGAGAGG + Intergenic
1197521211 X:127498957-127498979 ATGAAGAATCCCATTTAAAAGGG + Intergenic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1198432303 X:136579567-136579589 GTGAAGAAACACATTTGGCAGGG - Intergenic
1198486752 X:137095049-137095071 ATGATCAAACAGATTTAATAGGG + Intergenic
1198522362 X:137465854-137465876 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1198803476 X:140471085-140471107 CTGATGAAAGAGATTTAGAGAGG - Intergenic
1199027121 X:142953244-142953266 ATAAAAAAACAGATAAAGAAGGG - Intergenic
1199040089 X:143103095-143103117 AAGAAGAAACATATTTACTATGG + Intergenic
1199371256 X:147052041-147052063 ATCAAGAAACTACTTTAGAAAGG + Intergenic
1200077823 X:153560430-153560452 AGGAAGGAAGAGATTAAGAAGGG - Intronic
1200911780 Y:8537542-8537564 ATGAAGAGAAAGTTATAGAAAGG + Intergenic