ID: 1060575507 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:124688810-124688832 |
Sequence | GTGTTTATGTACATGTATTT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1060575505_1060575507 | 10 | Left | 1060575505 | 9:124688777-124688799 | CCTGGATTCCATAATTGAAACTG | 0: 1 1: 0 2: 0 3: 15 4: 129 |
||
Right | 1060575507 | 9:124688810-124688832 | GTGTTTATGTACATGTATTTAGG | No data | ||||
1060575506_1060575507 | 2 | Left | 1060575506 | 9:124688785-124688807 | CCATAATTGAAACTGCTTTCAAA | 0: 1 1: 0 2: 1 3: 39 4: 343 |
||
Right | 1060575507 | 9:124688810-124688832 | GTGTTTATGTACATGTATTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1060575507 | Original CRISPR | GTGTTTATGTACATGTATTT AGG | Intronic | ||
No off target data available for this crispr |