ID: 1060575507

View in Genome Browser
Species Human (GRCh38)
Location 9:124688810-124688832
Sequence GTGTTTATGTACATGTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060575505_1060575507 10 Left 1060575505 9:124688777-124688799 CCTGGATTCCATAATTGAAACTG 0: 1
1: 0
2: 0
3: 15
4: 129
Right 1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG No data
1060575506_1060575507 2 Left 1060575506 9:124688785-124688807 CCATAATTGAAACTGCTTTCAAA 0: 1
1: 0
2: 1
3: 39
4: 343
Right 1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060575507 Original CRISPR GTGTTTATGTACATGTATTT AGG Intronic
No off target data available for this crispr