ID: 1060575945

View in Genome Browser
Species Human (GRCh38)
Location 9:124694272-124694294
Sequence TGTAATTTTGCATGTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060575940_1060575945 7 Left 1060575940 9:124694242-124694264 CCTTTATCCATACATACACAGAT 0: 1
1: 0
2: 0
3: 49
4: 438
Right 1060575945 9:124694272-124694294 TGTAATTTTGCATGTTTTGGGGG No data
1060575939_1060575945 16 Left 1060575939 9:124694233-124694255 CCTTGAAGACCTTTATCCATACA 0: 1
1: 0
2: 2
3: 19
4: 173
Right 1060575945 9:124694272-124694294 TGTAATTTTGCATGTTTTGGGGG No data
1060575941_1060575945 0 Left 1060575941 9:124694249-124694271 CCATACATACACAGATAAATAGC 0: 1
1: 0
2: 1
3: 19
4: 247
Right 1060575945 9:124694272-124694294 TGTAATTTTGCATGTTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060575945 Original CRISPR TGTAATTTTGCATGTTTTGG GGG Intronic
No off target data available for this crispr