ID: 1060577494

View in Genome Browser
Species Human (GRCh38)
Location 9:124709967-124709989
Sequence GGGACATTGTTAGAAAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060577494 Original CRISPR GGGACATTGTTAGAAAGTAC TGG (reversed) Intronic
900520746 1:3104446-3104468 GGGACAGTGCTAGAGAGGACAGG + Intronic
901905636 1:12407148-12407170 GGGACAATGTTTAAAACTACAGG - Intronic
902963773 1:19983397-19983419 GTGATACTGTTAGATAGTACTGG + Intergenic
904632142 1:31850386-31850408 AGGACATTGTCAAAAAGTAATGG - Intergenic
904911913 1:33940848-33940870 TTGACATTATTAAAAAGTACAGG - Intronic
906863933 1:49394979-49395001 GGGGCATTGTTTGAAAAAACAGG - Intronic
907831393 1:58067649-58067671 GGAACATTTTAAAAAAGTACAGG + Intronic
908669520 1:66531412-66531434 GGGCCATTGTTAGGATGTAAGGG - Intergenic
910535319 1:88291066-88291088 GGGATCTTATTTGAAAGTACTGG - Intergenic
910686795 1:89925835-89925857 CTGACATTGCTGGAAAGTACTGG + Intronic
911035821 1:93546181-93546203 GGGAGATTGTGAGAAAGCAGAGG + Intronic
911133559 1:94416174-94416196 GGAACCTTGTGAGAAAGTAACGG - Intergenic
920090598 1:203450286-203450308 GGGACTGTTATAGAAAGTACTGG - Intergenic
921817228 1:219577573-219577595 GGAGCATTGTGAGAAAATACAGG - Intergenic
923932343 1:238716273-238716295 AGGTCACTGTTAAAAAGTACTGG + Intergenic
1064892375 10:20191844-20191866 GGGGCTTTGTAAGAAAGGACGGG + Intronic
1066377386 10:34869687-34869709 GGCATGTTGTTATAAAGTACAGG - Intergenic
1067494947 10:46753493-46753515 GGGACCTTGTTAGGAAATTCTGG - Intergenic
1071173046 10:82890084-82890106 GGAACCTTATTAGAAAATACAGG + Intronic
1071194973 10:83148218-83148240 TTGACATTTTTAGAAAGGACTGG - Intergenic
1071914249 10:90273227-90273249 GAGACACTGTTAGAAAGGCCAGG + Intergenic
1072833936 10:98691037-98691059 GGGACATTGTTAGTAAAAAAAGG - Intronic
1073805579 10:107094047-107094069 GGGAGAATGTTAGAAAGTCTGGG - Intronic
1080828503 11:35868596-35868618 GAGACATTTTTAGAAAATGCAGG + Intergenic
1086684002 11:89709122-89709144 AGGACATTTTTAGAACGTTCAGG - Intergenic
1090806268 11:130204263-130204285 GGGAAACTGTTAGAAAGGTCAGG + Intronic
1090985190 11:131760466-131760488 GGCGCATTGTTAAAAAGTGCTGG + Intronic
1091733244 12:2897330-2897352 GGGAAATTATTAGAAATTTCTGG + Intronic
1094346904 12:29480396-29480418 GGAACAATTTGAGAAAGTACTGG - Intronic
1096453436 12:51765521-51765543 GAGACACTGTTAGACAGTCCTGG + Intronic
1099072820 12:78067540-78067562 GGGGCATTATAAAAAAGTACTGG - Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1100167227 12:91929699-91929721 TGGACATTGCTAGAAAATTCTGG + Intergenic
1103792623 12:123482414-123482436 CGGATATTGCTAGAGAGTACAGG - Intronic
1109272862 13:60273614-60273636 TGGACTGTGGTAGAAAGTACTGG - Intergenic
1111339671 13:86867236-86867258 TTGACATTGTTAAAAAGTACAGG + Intergenic
1111617044 13:90672893-90672915 GGGAAATTGTCATAAAGTAAGGG + Intergenic
1120099587 14:80428936-80428958 GTGACATGATCAGAAAGTACTGG - Intergenic
1121970561 14:98352001-98352023 GGGACACTGTAACAAAGTACTGG - Intergenic
1121975316 14:98398189-98398211 GGGACAAATTTAAAAAGTACAGG + Intergenic
1123775004 15:23570511-23570533 GGGACATTTTTAGAATATATGGG + Intronic
1130719944 15:86376751-86376773 GTCACATTGTTAGACAGTCCTGG + Intronic
1131049610 15:89337809-89337831 GGTACATGCTTTGAAAGTACAGG - Intergenic
1132999051 16:2840067-2840089 GGGACATGGGGAGAAAGTCCAGG + Intergenic
1134516505 16:14891932-14891954 GAGACCTGGTTAGAAAGTGCCGG + Intronic
1134704177 16:16290583-16290605 GAGACCTGGTTAGAAAGTGCTGG + Intronic
1134963366 16:18421531-18421553 GAGACCTGGTTAGAAAGTGCTGG - Intronic
1134967661 16:18504130-18504152 GAGACCTGGTTAGAAAGTGCTGG - Intronic
1135993849 16:27233829-27233851 GGGAGCTTGTTAGAAAGGCCCGG - Intronic
1137008964 16:35304818-35304840 GGGACATTGTAACAAATCACTGG - Intergenic
1137308385 16:47228689-47228711 GGAACATTCTGACAAAGTACAGG - Intronic
1140269827 16:73455572-73455594 TGGAGCTTGTTAGAAAGTAAAGG - Intergenic
1141405141 16:83785897-83785919 AGGACACTGTTAGAATGTCCAGG - Intronic
1141845442 16:86605300-86605322 GGGACACTGTGAGAAAGAAATGG - Intergenic
1143812126 17:9480518-9480540 GGGAAGATCTTAGAAAGTACAGG + Intronic
1144416014 17:15047991-15048013 GAGACATTGTAAGAAAGCACAGG - Intergenic
1144664973 17:17096195-17096217 GGGACAGTGTGGGAAAGGACAGG - Intronic
1146593049 17:34145346-34145368 GGGACATTGGCAGATAGCACTGG - Intronic
1148143827 17:45347247-45347269 GGGTGCTTGTTAGAGAGTACTGG + Intergenic
1153620039 18:6968577-6968599 TGGACATTGTGAGAGAGTGCTGG - Intronic
1153701124 18:7694290-7694312 GAAACATTGTGAGAAATTACTGG + Intronic
1156829483 18:41473290-41473312 GGCTCTTTGTTTGAAAGTACAGG + Intergenic
1158880371 18:61773386-61773408 GGGACATTTTTACAAAATCCAGG - Intergenic
1159616228 18:70583244-70583266 GGGATAGTTTTAGAAAGTTCTGG + Intergenic
1164325828 19:24190654-24190676 GGGAGATTGTGAGATATTACTGG - Intergenic
1164719149 19:30419462-30419484 AGGGCATTCTTAGGAAGTACTGG - Intronic
1166080216 19:40439458-40439480 GGGTCATTGTCAGAAAGTGGAGG - Intergenic
925311820 2:2890185-2890207 GGTGCCTTGTTAGAAACTACAGG - Intergenic
926639648 2:15220431-15220453 GGGAAAATGATAGAAAGAACTGG - Intronic
928284306 2:29975602-29975624 GTTTCATTGTTAGAAAGTTCTGG - Intergenic
929182514 2:39057879-39057901 GTGATAGTGTTAGAAAGTTCAGG - Intronic
929893223 2:45936348-45936370 GGAACATGCTTAGAAAGTAAGGG + Intronic
931193168 2:60024955-60024977 GGGACATTGTAAGAACCCACAGG + Intergenic
936427869 2:112435271-112435293 GGGACATTATTAGCAAGGAGAGG - Intergenic
936669060 2:114634324-114634346 GGGACTTGGGTAGAAAGGACAGG - Intronic
937430349 2:121832713-121832735 GTGACATCGTTAGAAGTTACAGG + Intergenic
943809582 2:192167833-192167855 GGGTCATAGTTAGCAATTACTGG + Intronic
943818374 2:192285016-192285038 GAGATATTTTTACAAAGTACTGG + Intergenic
943867732 2:192949785-192949807 AGGGCATTGTTAGAATATACAGG + Intergenic
948199963 2:236122395-236122417 GGGACACAGTTATAAATTACAGG + Intronic
1169320645 20:4630692-4630714 GGGAGAATGATAGAAATTACTGG + Intergenic
1169568656 20:6883254-6883276 AGGCTATTGTTAAAAAGTACAGG + Intergenic
1171125731 20:22600367-22600389 GGGCCATTGCTGCAAAGTACTGG + Intergenic
1173237309 20:41258394-41258416 GGGACATCGGTAGAAAAAACCGG - Intronic
1174978209 20:55359579-55359601 GGGACATTGTTTGAAAGTTATGG - Intergenic
1175492722 20:59390006-59390028 AGGACATTGTTGGAATGTTCTGG + Intergenic
1176374380 21:6079940-6079962 GGGACATTATTAGCAAGGAGAGG + Intergenic
1178183771 21:30195564-30195586 TGGTCATTTTTAGAAAGTAAGGG - Intergenic
1179749096 21:43458305-43458327 GGGACATTATTAGCAAGGAGAGG - Intergenic
1183014037 22:34971360-34971382 GGGAGCTTGTTAGGAAGTACAGG - Intergenic
951834798 3:26971017-26971039 GGTACATAGGTAGAAAATACTGG - Intergenic
952553308 3:34503353-34503375 GTGAGATTGTCAGAAAATACAGG - Intergenic
956587651 3:70881602-70881624 GGGACATTCTATAAAAGTACTGG - Intergenic
968257916 3:197295786-197295808 GGTGCATTGTTTGAAAGAACTGG - Intronic
969946626 4:10790111-10790133 GGAAGATTATTAGAAAGTAGAGG + Intergenic
977428178 4:96896402-96896424 GTGACATGGTTAGAATTTACAGG + Intergenic
979820982 4:125171447-125171469 GGGTCAGTGTTATAAAATACCGG - Intergenic
980763966 4:137274429-137274451 AGGACATTTTTAAAAAGTAGTGG + Intergenic
983186126 4:164702611-164702633 GAGACTTTGTTAGAAAACACTGG + Intergenic
990533439 5:56696544-56696566 TGGATAGTGTTAAAAAGTACAGG + Intergenic
993484254 5:88462942-88462964 GGAGCATTGTTGGAAAGCACAGG + Intergenic
993500702 5:88663143-88663165 GGGAAAAAGTTAGAAAGTAGGGG + Intergenic
994269881 5:97764259-97764281 GGGACATTTTTAAGAAATACTGG - Intergenic
995195271 5:109359626-109359648 CTGACATTTTTAAAAAGTACAGG - Intronic
995285928 5:110388209-110388231 GTGACATTTATAGAATGTACTGG + Intronic
995376035 5:111475311-111475333 GGTACATTGTTGAAATGTACTGG + Intronic
998648674 5:144092907-144092929 GGGACATTGTAAGAATCAACAGG - Intergenic
1000794563 5:165648828-165648850 GGGACATCATTAAAAAGCACAGG + Intergenic
1004423290 6:15490050-15490072 GGGACATTGTGAGAAATAAAAGG + Intronic
1007025553 6:38568989-38569011 GGGACATAGGTAGGAATTACGGG + Intronic
1012219922 6:96637395-96637417 TTGACATTTTTAAAAAGTACAGG - Intergenic
1013831253 6:114275330-114275352 GGGACAATGTTAGCTACTACTGG - Intronic
1016402267 6:143693608-143693630 GGGACATTGCTAATAAGTCCTGG - Intronic
1019227892 6:170530174-170530196 GGCTGATTGTTAGAAAGTATAGG - Intergenic
1020375548 7:7481046-7481068 AGGACATTCTTAGCAATTACAGG - Intronic
1023742020 7:43289406-43289428 GGGACAGCATTAGAAAGTGCTGG - Intronic
1023801304 7:43837504-43837526 GAGACTTTGATAGAAAGGACAGG + Intergenic
1027484692 7:78746705-78746727 AGCACATTGTTCCAAAGTACAGG + Intronic
1030069987 7:105689906-105689928 GGGCCAGTGTGAGAAAGCACAGG + Intronic
1030455189 7:109763564-109763586 GGGTCATTGCAAGAAAGTTCTGG + Intergenic
1033466887 7:141600189-141600211 TTGACATTGATTGAAAGTACTGG + Intronic
1041354105 8:56981825-56981847 GGGAGCTTGTCAGAAAGCACAGG - Intronic
1044559193 8:93595992-93596014 GGAAAATTGTCAGAAAATACAGG - Intergenic
1045989592 8:108290023-108290045 GGGAAAGTTCTAGAAAGTACTGG + Intronic
1046645662 8:116782799-116782821 GTGACATTATTTGAAAGTAGGGG - Intronic
1052374455 9:27702463-27702485 GTTACATGGCTAGAAAGTACAGG + Intergenic
1052638152 9:31129210-31129232 GTGACCTAGTAAGAAAGTACTGG + Intergenic
1052822589 9:33149836-33149858 GTGACATTGTTGAAGAGTACAGG - Intronic
1054773578 9:69105662-69105684 AGTACATTATTAAAAAGTACAGG + Intergenic
1055269331 9:74539535-74539557 GAGACACTGTTTTAAAGTACTGG + Intronic
1060577494 9:124709967-124709989 GGGACATTGTTAGAAAGTACTGG - Intronic
1186943212 X:14535469-14535491 GAGACATTCTTAGAAACTACAGG + Intronic
1188306179 X:28562051-28562073 AAGACATTGTTGGAATGTACTGG + Intergenic
1192101865 X:68273030-68273052 TGGGCATTGTTAGAAATGACTGG - Intronic
1194705681 X:97172799-97172821 GGGAGATAGTTTGAAAGTAGGGG - Intronic
1198223604 X:134625430-134625452 TGGAAATTGTTAGAAAGCAGAGG - Intronic
1201601512 Y:15733793-15733815 GGGACATTCTTCGGTAGTACTGG - Intergenic