ID: 1060577604

View in Genome Browser
Species Human (GRCh38)
Location 9:124711448-124711470
Sequence TGTGAATGTTGTCTAAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060577604_1060577611 27 Left 1060577604 9:124711448-124711470 CCACATCTTAGACAACATTCACA No data
Right 1060577611 9:124711498-124711520 TGGAGTGTCAGACCCAAAAATGG No data
1060577604_1060577607 7 Left 1060577604 9:124711448-124711470 CCACATCTTAGACAACATTCACA No data
Right 1060577607 9:124711478-124711500 CTTTATCCATGCCCAAGGAATGG No data
1060577604_1060577605 2 Left 1060577604 9:124711448-124711470 CCACATCTTAGACAACATTCACA No data
Right 1060577605 9:124711473-124711495 CACTCCTTTATCCATGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060577604 Original CRISPR TGTGAATGTTGTCTAAGATG TGG (reversed) Intronic