ID: 1060577606

View in Genome Browser
Species Human (GRCh38)
Location 9:124711477-124711499
Sequence CATTCCTTGGGCATGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060577606_1060577611 -2 Left 1060577606 9:124711477-124711499 CCTTTATCCATGCCCAAGGAATG No data
Right 1060577611 9:124711498-124711520 TGGAGTGTCAGACCCAAAAATGG No data
1060577606_1060577612 3 Left 1060577606 9:124711477-124711499 CCTTTATCCATGCCCAAGGAATG No data
Right 1060577612 9:124711503-124711525 TGTCAGACCCAAAAATGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060577606 Original CRISPR CATTCCTTGGGCATGGATAA AGG (reversed) Intronic