ID: 1060577608 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:124711484-124711506 |
| Sequence | GACACTCCATTCCTTGGGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060577608_1060577611 | -9 | Left | 1060577608 | 9:124711484-124711506 | CCATGCCCAAGGAATGGAGTGTC | No data | ||
| Right | 1060577611 | 9:124711498-124711520 | TGGAGTGTCAGACCCAAAAATGG | No data | ||||
| 1060577608_1060577612 | -4 | Left | 1060577608 | 9:124711484-124711506 | CCATGCCCAAGGAATGGAGTGTC | No data | ||
| Right | 1060577612 | 9:124711503-124711525 | TGTCAGACCCAAAAATGGCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060577608 | Original CRISPR | GACACTCCATTCCTTGGGCA TGG (reversed) | Intronic | ||