ID: 1060577610

View in Genome Browser
Species Human (GRCh38)
Location 9:124711490-124711512
Sequence GGGTCTGACACTCCATTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060577610_1060577612 -10 Left 1060577610 9:124711490-124711512 CCAAGGAATGGAGTGTCAGACCC No data
Right 1060577612 9:124711503-124711525 TGTCAGACCCAAAAATGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060577610 Original CRISPR GGGTCTGACACTCCATTCCT TGG (reversed) Intronic