ID: 1060577612

View in Genome Browser
Species Human (GRCh38)
Location 9:124711503-124711525
Sequence TGTCAGACCCAAAAATGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060577610_1060577612 -10 Left 1060577610 9:124711490-124711512 CCAAGGAATGGAGTGTCAGACCC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1060577612 9:124711503-124711525 TGTCAGACCCAAAAATGGCGAGG No data
1060577609_1060577612 -9 Left 1060577609 9:124711489-124711511 CCCAAGGAATGGAGTGTCAGACC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1060577612 9:124711503-124711525 TGTCAGACCCAAAAATGGCGAGG No data
1060577606_1060577612 3 Left 1060577606 9:124711477-124711499 CCTTTATCCATGCCCAAGGAATG 0: 1
1: 0
2: 3
3: 11
4: 157
Right 1060577612 9:124711503-124711525 TGTCAGACCCAAAAATGGCGAGG No data
1060577608_1060577612 -4 Left 1060577608 9:124711484-124711506 CCATGCCCAAGGAATGGAGTGTC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1060577612 9:124711503-124711525 TGTCAGACCCAAAAATGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060577612 Original CRISPR TGTCAGACCCAAAAATGGCG AGG Intronic
No off target data available for this crispr