ID: 1060579638

View in Genome Browser
Species Human (GRCh38)
Location 9:124733313-124733335
Sequence GAATTGGCAGAGCTTGACCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060579638_1060579641 10 Left 1060579638 9:124733313-124733335 CCTGGGTCAAGCTCTGCCAATTC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1060579641 9:124733346-124733368 AAACCTAAAGAGAAAACAATAGG 0: 1
1: 0
2: 4
3: 64
4: 767

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060579638 Original CRISPR GAATTGGCAGAGCTTGACCC AGG (reversed) Exonic
905881371 1:41466410-41466432 GAATGGACAGGGCTTGAGCCAGG + Intergenic
906514397 1:46430343-46430365 TAAGTGGCAGAGCTGGACCCAGG - Intergenic
907012479 1:50977289-50977311 CTATGGGCAGAGCTTTACCCGGG - Intergenic
910980348 1:92954469-92954491 GAGGTGGGAGAGCTTGAACCCGG - Intronic
915434750 1:155895845-155895867 GAATTGGAATTGCTTGAACCCGG - Intergenic
920089350 1:203441287-203441309 GATTTGGCAGAGGATGACACAGG - Intergenic
1063746684 10:8891537-8891559 GAATTAGCAGGACCTGACCCTGG - Intergenic
1064176729 10:13081529-13081551 AACTTGGTAGGGCTTGACCCTGG - Intronic
1064255315 10:13738429-13738451 GAGTTGGCCCAGCTTTACCCAGG + Intronic
1065010593 10:21417327-21417349 GAGCTGGCAGAGCCTGTCCCTGG + Intergenic
1066585284 10:36926967-36926989 GAATTAGCAGTCCTTGACCCAGG + Intergenic
1071479549 10:86054622-86054644 GAGTTTGCAGAGCTAGACACAGG - Intronic
1074661588 10:115664880-115664902 GAAGTGGAATAGCTTGACACAGG - Intronic
1076405475 10:130209476-130209498 GAAATGAGAGAGCTGGACCCTGG - Intergenic
1077053518 11:578528-578550 GCAATGGCAGGGCTTGCCCCAGG - Intronic
1079964501 11:26964682-26964704 CATTTTGCAGAGCTTCACCCAGG - Intergenic
1081715984 11:45250916-45250938 GAAATGGCAGACCTTGAGGCCGG - Intronic
1083998534 11:66283913-66283935 CAAGGGGCAGAGCTTGACCCTGG + Exonic
1084466797 11:69328061-69328083 GAATGGGCACAGCTTTGCCCGGG - Intronic
1084893380 11:72248286-72248308 GAAATGGCAGGGCTTAAGCCAGG - Intergenic
1085902903 11:80723204-80723226 GAATTAGCAGCCCCTGACCCAGG - Intergenic
1087922085 11:103877842-103877864 GAAAAGGCAGAGCTTGGCCTGGG - Intergenic
1089122456 11:116146970-116146992 GAAGTTGCAGAAATTGACCCTGG + Intergenic
1090793186 11:130110153-130110175 GAAATTACAGAACTTGACCCTGG - Intronic
1092099359 12:5870354-5870376 GAAGTGGCAGAGCTGGCACCAGG - Intronic
1092430956 12:8408463-8408485 GAATTGGCACAGGTTCATCCGGG - Intergenic
1094237867 12:28189556-28189578 GAATTGTCAAAACTTGGCCCAGG + Intronic
1094614770 12:32026230-32026252 AACTTGGTAGGGCTTGACCCTGG - Intergenic
1095646675 12:44556343-44556365 GGATAGGCAGAGCTTGTCCTTGG + Intronic
1095949519 12:47774093-47774115 GATTTGGCAGAGCTTGGCTGAGG - Intronic
1096222284 12:49838529-49838551 GATTGTGCAGATCTTGACCCAGG - Exonic
1100472768 12:94908475-94908497 GAATTGCCATAGATTGACCCAGG - Intronic
1102867723 12:116387297-116387319 GAAATGGGAGTGCTTGACCAAGG + Intergenic
1113366584 13:109682313-109682335 GAATTGGAAGTGTTTGAGCCAGG - Intergenic
1113753330 13:112791464-112791486 GCAGCGGCAGAGCTTGATCCAGG + Intronic
1113905926 13:113819186-113819208 GAATGGGCAGAGCTTCTCCAAGG - Intergenic
1116764977 14:49059426-49059448 GAATTGGCAGAATTTCACCATGG - Intergenic
1117657439 14:57970835-57970857 GAATTCTCAGAGGTTGACCTTGG - Intronic
1118865365 14:69698985-69699007 GAATTGTCAGAGAATGATCCTGG + Intronic
1122396892 14:101439987-101440009 GAAATGGCAGAGCCTGCCCTTGG + Intergenic
1122424825 14:101599745-101599767 GATTTGGCAAAGCTGCACCCAGG - Intergenic
1122455247 14:101845306-101845328 GATTTGGCAGAGTCTGAACCGGG + Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1128874350 15:71190031-71190053 GGATTAGAAGAGCTAGACCCGGG + Intronic
1130835819 15:87648929-87648951 TAATTAGCAGAGCTGCACCCTGG - Intergenic
1134352984 16:13455283-13455305 GAATTGGCAGAGAATGACTTGGG - Intergenic
1135233533 16:20732537-20732559 GTCTTTGCAGAGCTGGACCCTGG - Intronic
1141486458 16:84343435-84343457 GAATTGGCTCAGCTTGAGTCAGG - Intergenic
1147090686 17:38096300-38096322 GGATTGCCAGTGCTTGAGCCCGG + Intergenic
1147106527 17:38224226-38224248 GGATTGCCAGTGCTTGAGCCCGG - Intergenic
1148367418 17:47066775-47066797 AATTTGGTAGGGCTTGACCCTGG + Intergenic
1149502624 17:57165734-57165756 GGCTTGGCGGAGCTTGACTCTGG - Intergenic
1150484447 17:65533952-65533974 GAAGGCTCAGAGCTTGACCCTGG - Exonic
1156786636 18:40923092-40923114 GAAAAGGAAGAGCTTGCCCCAGG - Intergenic
1161610337 19:5238636-5238658 GAAGTGGCTGATCTTGGCCCTGG - Intronic
1162137855 19:8567153-8567175 GAATTGGAATTGCTTGAACCTGG - Intronic
1162285768 19:9737618-9737640 GCATTGGAATAGCTTGAACCTGG - Intergenic
1163911664 19:20199983-20200005 GAATTGGAATTGCTTGAACCTGG + Exonic
1165739543 19:38197217-38197239 GAATCGGCAGAGCCTGACCGTGG - Intronic
925447922 2:3943392-3943414 GAACAGGCAGACCCTGACCCAGG - Intergenic
925591245 2:5512248-5512270 CACTTGGCAGTGCTTGTCCCTGG + Intergenic
926503331 2:13681052-13681074 AACTTGGTAGAGCTTGACCCTGG - Intergenic
930318917 2:49830091-49830113 GAATTGGCAGATCAGGAACCAGG + Intergenic
931876664 2:66520840-66520862 GAACTGGCTGAGCTTGAACCAGG + Intronic
934971349 2:98766970-98766992 GAATCCTCAGAGCATGACCCTGG + Intergenic
937057281 2:118949674-118949696 AATTTGGTAGGGCTTGACCCAGG + Intronic
940275592 2:151937278-151937300 CCAATGGTAGAGCTTGACCCTGG - Intronic
940467899 2:154055904-154055926 GAATAGCCAAATCTTGACCCAGG - Intronic
942148478 2:173050564-173050586 GGAGTGGCAGAGCCAGACCCTGG - Intronic
943295205 2:186129635-186129657 GCAGTAGCAGAGCTTGGCCCAGG + Intergenic
944085662 2:195845066-195845088 GAATTGTCACAGCTTCTCCCAGG + Exonic
945234366 2:207621010-207621032 GATTTGGCAGGGCTGGACCAGGG - Intronic
1169423103 20:5475303-5475325 GGATTGGCTGAGCATGAGCCAGG + Intergenic
1171948407 20:31399100-31399122 CAATTGGCAGGGCTGGATCCAGG + Intergenic
1172032699 20:31992987-31993009 GAAATGCCAGCGCTTCACCCTGG + Intronic
1172847193 20:37936714-37936736 GAGGTGGCAGAGCTGGAACCAGG - Intronic
1173458890 20:43225835-43225857 GAATTGGCAGAGGTGGAGCTTGG + Intergenic
1175707393 20:61190667-61190689 AACTTGGTAGGGCTTGACCCTGG + Intergenic
1175861095 20:62150904-62150926 GAATCGGCAGAGCTGGCCTCTGG + Intronic
1181687748 22:24541309-24541331 GCATTGGAAGAGCAGGACCCAGG + Intronic
1183815718 22:40298669-40298691 GAAATGGCAGAGCTGGGGCCGGG + Intronic
1184342254 22:43892320-43892342 GAAGTGGCAGAGTCGGACCCAGG + Intergenic
949802698 3:7920945-7920967 GTATTGGCAGAGATGGAGCCAGG - Intergenic
959348176 3:105225938-105225960 GAATTGCTTGAACTTGACCCGGG + Intergenic
959800367 3:110487109-110487131 GAATTAGACCAGCTTGACCCAGG + Intergenic
961522300 3:127473758-127473780 CAGTTGGCAGAGCCTGAGCCAGG + Intergenic
962001785 3:131305556-131305578 GAATTGGCATGTCTTGTCCCTGG + Intronic
962854442 3:139331116-139331138 GAATTAGCAGAGCAGGGCCCAGG - Intronic
962924496 3:139979102-139979124 GAACTGTGAGAGCTTGACCCTGG + Intronic
963043753 3:141087674-141087696 GGAGTGGCAGAGCTGGACCAGGG + Intronic
969564835 4:7971551-7971573 GAAGTGGCAGAGCCAGACCTGGG + Intronic
970243655 4:14035573-14035595 GAATTTGGAGATCTTGACCAAGG - Intergenic
970960541 4:21866330-21866352 GAATAAACAGAGCTTGACCCTGG - Intronic
971398581 4:26253905-26253927 GACTTGGAAGTGCTTGACACAGG - Intronic
973138229 4:46733193-46733215 GAAATGTCAGATCTTGAGCCAGG + Intergenic
974061837 4:57042441-57042463 GAATTGCTTGAGCTTGAACCCGG - Intronic
974285232 4:59856253-59856275 GAGTTGGCAGAGCGGGAGCCGGG - Intergenic
975472942 4:74791902-74791924 GAAGTGGTAGAGCTGGAACCAGG + Intronic
981746878 4:148060890-148060912 GAATGTGGAGAACTTGACCCTGG + Intronic
983943210 4:173558148-173558170 GAATTAGCAGAACTGGAACCTGG + Intergenic
984688340 4:182696916-182696938 GAAGTGACAGAGCTGGAACCAGG - Intronic
985861440 5:2474417-2474439 GGATTTGCAGAACTTGATCCGGG - Intergenic
986073045 5:4306299-4306321 GTATTTGCAGAGCTTGTCCTGGG + Intergenic
986417856 5:7546487-7546509 GAAGTGGCAGAGCTGGATTCGGG + Intronic
987198441 5:15550602-15550624 GAATAGCCAGAGGTAGACCCAGG + Intronic
990588406 5:57235778-57235800 GAGTAGGCAGAGCGTGACACTGG + Intronic
1002084938 5:176768681-176768703 CTATTGGCAGAGCCTGGCCCTGG + Intergenic
1003574241 6:7278085-7278107 TAAGTGGCAGAGCTGGACACAGG - Intronic
1004420175 6:15462306-15462328 GAATGGGCAGAGATTGGCACTGG + Intronic
1006623392 6:35383107-35383129 GAGTGGGCAGGGCTTGAACCTGG + Intronic
1008519330 6:52348154-52348176 TAATTGGCAAAGCTTGGGCCAGG + Intergenic
1012114733 6:95281966-95281988 TAATTGGGAGAACTTGAACCTGG - Intergenic
1013835849 6:114334263-114334285 GAATTGGAAAAGCTTGCCACGGG - Intronic
1015555244 6:134454328-134454350 GGATTGGCAGAACGTGAGCCAGG + Intergenic
1016816388 6:148306817-148306839 GAATTGGGAGAGCTTCATCCTGG + Intronic
1023907233 7:44531434-44531456 GAATTCGCAGGGCTGGACACTGG + Intronic
1037493160 8:19414361-19414383 GAACTGGCAAAGCTTGAACCAGG + Intronic
1041395252 8:57383686-57383708 GAAATGGAGGAGCTTGAACCAGG + Intergenic
1043083632 8:75798869-75798891 GATTTGACAGAGCTTGACAAAGG + Intergenic
1047180205 8:122580326-122580348 GACTTGGCCCAGATTGACCCAGG + Intergenic
1047962317 8:130019461-130019483 GAATTGCCAGAGGTTTCCCCGGG - Intergenic
1048209650 8:132444099-132444121 GTATTGCCAGAGGTGGACCCTGG - Intronic
1049150092 8:141029533-141029555 GAATCTGAAGAGCCTGACCCTGG - Intergenic
1049306171 8:141905427-141905449 GCATTGGCAGAGCCTGACCTGGG + Intergenic
1049637803 8:143698531-143698553 GAGTTGGCAGAACCTGACCCGGG + Intronic
1051022005 9:12555993-12556015 TAATTGGCAGGGCCTGTCCCTGG - Intergenic
1056125315 9:83530924-83530946 TAAGGTGCAGAGCTTGACCCTGG - Intronic
1058959426 9:109978889-109978911 GAGCTGGCAGATGTTGACCCTGG + Intronic
1059564449 9:115369450-115369472 GAATTGGCTCAGCCTGACACAGG + Intronic
1060579638 9:124733313-124733335 GAATTGGCAGAGCTTGACCCAGG - Exonic
1061046128 9:128166147-128166169 GCATTAGCAGATCTGGACCCAGG + Exonic
1061377847 9:130236664-130236686 GAAGGGGCAGAGCCTGAGCCTGG - Exonic
1061417294 9:130454045-130454067 GCATTGGCTGAGCCTGGCCCTGG - Intronic
1203789773 EBV:144543-144565 GTGGTGGCAGAGCTTGGCCCTGG + Intergenic
1188841576 X:35024104-35024126 CAATAGGCAGAGCTTGATTCAGG + Intergenic
1193952108 X:87812378-87812400 GAAATGGCAGAGCCTGGCCTTGG - Intergenic
1194726069 X:97398833-97398855 GAATTGGAATTGCTTGAACCCGG - Intronic
1197994129 X:132354082-132354104 GATCTGGCAGAGTTGGACCCAGG - Intergenic