ID: 1060583452

View in Genome Browser
Species Human (GRCh38)
Location 9:124771341-124771363
Sequence CGCTGCCGCGCAAGGCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060583447_1060583452 -6 Left 1060583447 9:124771324-124771346 CCCCTGACGTCACACGCCGCTGC 0: 1
1: 0
2: 1
3: 4
4: 55
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583443_1060583452 16 Left 1060583443 9:124771302-124771324 CCTCAGCACTGGCCAGCTCCCTC 0: 1
1: 0
2: 5
3: 58
4: 458
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583445_1060583452 -2 Left 1060583445 9:124771320-124771342 CCCTCCCCTGACGTCACACGCCG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583437_1060583452 29 Left 1060583437 9:124771289-124771311 CCGCGCCGCGCCCCCTCAGCACT 0: 1
1: 0
2: 0
3: 22
4: 260
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583442_1060583452 17 Left 1060583442 9:124771301-124771323 CCCTCAGCACTGGCCAGCTCCCT 0: 1
1: 0
2: 5
3: 43
4: 355
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583449_1060583452 -8 Left 1060583449 9:124771326-124771348 CCTGACGTCACACGCCGCTGCCG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583439_1060583452 24 Left 1060583439 9:124771294-124771316 CCGCGCCCCCTCAGCACTGGCCA 0: 1
1: 0
2: 3
3: 34
4: 327
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583441_1060583452 18 Left 1060583441 9:124771300-124771322 CCCCTCAGCACTGGCCAGCTCCC 0: 1
1: 0
2: 2
3: 46
4: 401
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583448_1060583452 -7 Left 1060583448 9:124771325-124771347 CCCTGACGTCACACGCCGCTGCC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583446_1060583452 -3 Left 1060583446 9:124771321-124771343 CCTCCCCTGACGTCACACGCCGC 0: 1
1: 0
2: 1
3: 5
4: 53
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583440_1060583452 19 Left 1060583440 9:124771299-124771321 CCCCCTCAGCACTGGCCAGCTCC 0: 1
1: 0
2: 5
3: 49
4: 369
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108
1060583444_1060583452 4 Left 1060583444 9:124771314-124771336 CCAGCTCCCTCCCCTGACGTCAC 0: 1
1: 0
2: 0
3: 36
4: 483
Right 1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060583452 Original CRISPR CGCTGCCGCGCAAGGCCCTG CGG Intergenic
900663180 1:3796213-3796235 TGCTGCGGCGCAACGCGCTGGGG - Exonic
901458243 1:9376259-9376281 GGCTGCCGAGCAAAGGCCTGTGG - Intergenic
904744634 1:32703118-32703140 CGCTGCCGCTCAGCGCCCTCTGG + Exonic
905668643 1:39777468-39777490 CGCTTCCAGGAAAGGCCCTGTGG + Intronic
912446484 1:109740428-109740450 CGCGCCTGCGCACGGCCCTGTGG - Exonic
912459870 1:109823533-109823555 TGCTGCTGCCCAAGGCCTTGGGG + Intergenic
924739566 1:246786907-246786929 CCCTGCCCCACAAGGCCTTGAGG + Intergenic
1063575936 10:7262006-7262028 CGCTGAAGGGCAAGGCCCGGTGG + Intronic
1065637692 10:27746802-27746824 CGCTCTCGCCGAAGGCCCTGTGG + Intergenic
1069739709 10:70679615-70679637 CTCTGCCTCCCCAGGCCCTGGGG + Intronic
1072141535 10:92593049-92593071 CGCTGGCGCGCAAGGCACCATGG - Intergenic
1072748946 10:97962672-97962694 CGCTACTGAGCAAGGCTCTGCGG + Intronic
1073181912 10:101588466-101588488 CTCTGCCGACCCAGGCCCTGAGG - Intronic
1075207846 10:120462283-120462305 CCCTGCCCTGCAGGGCCCTGAGG - Intronic
1076392111 10:130110834-130110856 CCCTTCCGCACAAGGCCCTGGGG + Intergenic
1077144789 11:1040036-1040058 CCCTGCCCCGCTGGGCCCTGTGG + Intergenic
1079126490 11:17721451-17721473 CGCCGCCCCGCAGTGCCCTGCGG + Exonic
1083632742 11:64104150-64104172 CGCTGCCGCCCAAGACCCTCTGG - Exonic
1084398638 11:68931131-68931153 CGCTGCCATTCATGGCCCTGGGG + Intronic
1085388334 11:76169757-76169779 CGCTGCAGCTCAGGGCCCTGGGG + Intergenic
1085409778 11:76284224-76284246 CTCGGCTGAGCAAGGCCCTGGGG - Intergenic
1085781295 11:79411534-79411556 GGCTGCAGCGCAAGGCCAGGAGG - Intronic
1089822567 11:121241568-121241590 CACTGCCACTCATGGCCCTGGGG + Intergenic
1091315140 11:134609443-134609465 CCCTGCCGCTGAAGGTCCTGCGG + Intergenic
1091685668 12:2560104-2560126 GGCTGCCACGCAAGGCCACGTGG + Intronic
1092239565 12:6828613-6828635 CGCTGCTGCGGGAGGCGCTGCGG + Exonic
1094845122 12:34358158-34358180 CGCTCATGCGCAAGGCCCAGGGG - Intergenic
1096478614 12:51923637-51923659 CCCTGCCGGGAAAGGCCCCGCGG - Intergenic
1101381231 12:104215784-104215806 CCATGTCGCACAAGGCCCTGTGG - Exonic
1103942257 12:124507574-124507596 CGCTGCCCAGCCATGCCCTGTGG - Intronic
1104830556 12:131747982-131748004 CGCTGCCGAGGAAGAGCCTGGGG + Intronic
1113859627 13:113472841-113472863 ACCTGCTGTGCAAGGCCCTGGGG - Intronic
1114630644 14:24157464-24157486 CGCTGCAACTCAAGGCCCTCAGG - Intronic
1118786875 14:69053574-69053596 GTGTGCCGCGCAAGGCTCTGTGG - Exonic
1122876054 14:104665926-104665948 CGGTGCCACGCCAGGGCCTGCGG - Intergenic
1122997902 14:105275504-105275526 CGCGGCCCAGCAAGGCCCAGAGG + Intronic
1124709052 15:31990017-31990039 GGCTGCCCCACAAGGCCCAGAGG - Intergenic
1124937538 15:34186775-34186797 CGCTGCCATTCATGGCCCTGGGG - Intronic
1125436011 15:39645840-39645862 TGCTGCCGTTCATGGCCCTGGGG - Intronic
1127017790 15:54708272-54708294 CGCTGCCATTCATGGCCCTGGGG + Intergenic
1128245114 15:66127734-66127756 AGCTGCGGCGCTAGGTCCTGGGG - Intronic
1128736116 15:70054952-70054974 CGATGCTGAGCCAGGCCCTGGGG + Intronic
1132111634 15:99105906-99105928 CGCTGCGGCGCGAGGCGCTCGGG + Exonic
1135347953 16:21705297-21705319 AGCTGGGGTGCAAGGCCCTGAGG + Intronic
1136630605 16:31487509-31487531 GGCTGCCGGGCAAGGCCGTCAGG - Exonic
1139475229 16:67199599-67199621 TGCTGCCGGGCCAGGGCCTGCGG + Intronic
1142134515 16:88445496-88445518 CCCAGCCGCGCCAGGCCCTGGGG - Intergenic
1143023489 17:3928463-3928485 CCCTGCAGTGCAAGACCCTGCGG + Intronic
1143128379 17:4659674-4659696 CTCTGCCTCCCAAGGCGCTGGGG + Intergenic
1145789774 17:27619120-27619142 CGCTGCCAAGAAAGCCCCTGAGG + Intronic
1147677787 17:42219571-42219593 CTCTGCCTCGCAAGGCCCCCAGG + Intronic
1147688249 17:42300000-42300022 CTCTGCCTCGCAAGGCCCCCAGG - Intronic
1147742795 17:42678303-42678325 CGCTGCTGCGGGAGGCTCTGAGG + Intergenic
1152390697 17:80002117-80002139 AGCTCCCACGGAAGGCCCTGGGG - Intronic
1152730339 17:81966927-81966949 CCCTGGCGCTCAAGGCCCTGGGG - Intergenic
1152804474 17:82348560-82348582 CCCTGCAGCCCCAGGCCCTGGGG - Intergenic
1153707061 18:7756860-7756882 GGCTGCTGTGCATGGCCCTGTGG + Intronic
1157592345 18:48843312-48843334 TGCTGGAGCGCAGGGCCCTGGGG - Intronic
1157599466 18:48885283-48885305 CGGTGGCCCCCAAGGCCCTGTGG - Intergenic
1159955966 18:74518837-74518859 AGATGCTGTGCAAGGCCCTGGGG - Intronic
1160847294 19:1172245-1172267 CCCTGCCGTGGGAGGCCCTGAGG + Intronic
1161264604 19:3358609-3358631 CCCTGCCGCGCGAGCCGCTGCGG - Intergenic
1161480501 19:4508009-4508031 CGTTGCAGCCCCAGGCCCTGCGG + Intronic
1165932659 19:39369989-39370011 CCCTGCAGAGCTAGGCCCTGGGG + Exonic
1166351310 19:42199733-42199755 AGCTGCCGCGCCAGCGCCTGGGG + Exonic
1166822842 19:45591233-45591255 CGCTGCCCCGCACGGCCCGCAGG + Exonic
925042105 2:740193-740215 CGCTCCCTCGCTAGGCTCTGAGG - Intergenic
925384433 2:3452300-3452322 CCCGGCCGTGCAAGGCACTGTGG - Intronic
925759220 2:7168210-7168232 GGCAGCCACACAAGGCCCTGTGG - Intergenic
928439861 2:31283396-31283418 TGCTTCCTCCCAAGGCCCTGGGG - Intergenic
932595088 2:73088554-73088576 CGGTGCCGCACAGGGCCCTGGGG + Exonic
936152140 2:110027757-110027779 ACCTGCCGCACAAGGCCCAGAGG + Intergenic
936192538 2:110343656-110343678 ACCTGCCGCACAAGGCCCAGAGG - Intergenic
936530775 2:113276004-113276026 CGCTCCCGCGGAAAGCCGTGTGG + Intronic
941978577 2:171431741-171431763 CACTCCCGCCCATGGCCCTGGGG - Intronic
948889831 2:240902126-240902148 TGCTGCCGTGGCAGGCCCTGGGG - Intergenic
1172227804 20:33316902-33316924 CGCTGCTGCCCCAGGCCCAGGGG + Intergenic
1175514363 20:59559547-59559569 CGCTCCTGCGCAGAGCCCTGGGG + Intergenic
1176234673 20:64048820-64048842 AGCAGGCGCGCAAGGCCCGGCGG - Exonic
1180135187 21:45857891-45857913 CACTGGAGAGCAAGGCCCTGGGG - Intronic
1183491154 22:38116284-38116306 CTCTGCTACCCAAGGCCCTGGGG - Intronic
950244159 3:11399857-11399879 CGCTTCCACGCCAGGCACTGTGG - Intronic
952845295 3:37683074-37683096 TGCTGGCCCTCAAGGCCCTGTGG + Intronic
953608072 3:44424727-44424749 GGCTGCTGGGCAAGCCCCTGGGG - Intergenic
956979053 3:74614877-74614899 CGCCGCCGCCCAGGGCCCTGCGG - Intergenic
961324906 3:126104237-126104259 GGATGCCTCGCAGGGCCCTGAGG + Intronic
963189012 3:142448125-142448147 CCCGGCCGCGCGAGGCCCGGAGG - Intergenic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
966936301 3:184711872-184711894 AGCCGCCGCGCAAGCCCCGGGGG + Exonic
967171149 3:186824696-186824718 CGCTTCCCTGCAGGGCCCTGGGG + Intergenic
967979783 3:195058870-195058892 CGCTGACACGCCAGGCCCCGGGG + Intergenic
968540899 4:1167887-1167909 AGCTGCCGCTCAAGTCCCTGTGG + Intronic
978754209 4:112285623-112285645 CGCCGCCCCGCAAGTACCTGGGG + Exonic
983577046 4:169271124-169271146 CGCTCCCGGGGAAGGCGCTGTGG - Intergenic
985565843 5:616766-616788 GGCTGCTGCGCAAGGCCAGGTGG + Intronic
985824386 5:2181772-2181794 CCCTGCGGTGCCAGGCCCTGGGG - Intergenic
986288423 5:6378309-6378331 CGCTTCCCGGCCAGGCCCTGGGG + Intronic
986748173 5:10761662-10761684 CGCTGCCGCGGCAGGGGCTGAGG - Intergenic
994631867 5:102296617-102296639 CGCCTCCGCCCAAGCCCCTGCGG + Intergenic
999205842 5:149847332-149847354 GGCTGCAGCCCAAGGCCTTGGGG - Intronic
1001085329 5:168696399-168696421 CGCTGCCCCTCAAAGCCCAGAGG + Exonic
1006635818 6:35460453-35460475 CACAGCAGGGCAAGGCCCTGGGG - Intronic
1012450581 6:99349585-99349607 TGCTGCCGCCCAGGGCTCTGGGG - Exonic
1012973611 6:105756693-105756715 GGCTGCAGCGCCAGGTCCTGAGG + Intergenic
1016340890 6:143060752-143060774 CGCGGCCGCGCCAGTCCCCGGGG + Intronic
1020016892 7:4836438-4836460 CGCTGCCGCCCAGGGCCCCGAGG - Exonic
1034269334 7:149796112-149796134 AGGTGCCGAGCCAGGCCCTGGGG + Intergenic
1035446663 7:158947827-158947849 CGCTGCCTCGGAAGCACCTGTGG + Intronic
1038566361 8:28622786-28622808 CGCTGCAGCGCCAGGTCCCGCGG - Intronic
1042396023 8:68292780-68292802 CGCTGCCAGTCAAGGCCCTGTGG - Intergenic
1047866941 8:129035185-129035207 TGCTGCCTCGCAGGGCCCTGGGG - Intergenic
1049151206 8:141036623-141036645 CGCTGCCGCCAAAGGCTCTGGGG + Intergenic
1049719635 8:144109782-144109804 GCCTGCCGCGCGAGGCGCTGTGG + Exonic
1053801146 9:41765222-41765244 CGCTGCCGAGACAGGCCATGAGG + Intergenic
1054144055 9:61549615-61549637 CGCTGCCGAGACAGGCCATGAGG - Intergenic
1054648938 9:67611237-67611259 CGCTGCCGAGACAGGCCATGAGG - Intergenic
1056746842 9:89310784-89310806 AGCTTCCGCTCAAAGCCCTGTGG + Intergenic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1057904774 9:98975097-98975119 CGCTGCCGCGCACGGTCCCGGGG + Intronic
1060193493 9:121607966-121607988 CTCTGCCGGGAAAGGCTCTGAGG - Intronic
1060583452 9:124771341-124771363 CGCTGCCGCGCAAGGCCCTGCGG + Intergenic
1198530708 X:137548113-137548135 CGCTGGCGCACAAGCTCCTGCGG + Intergenic