ID: 1060583696

View in Genome Browser
Species Human (GRCh38)
Location 9:124772526-124772548
Sequence TTTCGTAGCAGGTGAGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060583696_1060583703 3 Left 1060583696 9:124772526-124772548 CCCGTCCCTCACCTGCTACGAAA No data
Right 1060583703 9:124772552-124772574 GCAACGCTTCTCTGCACTTGGGG No data
1060583696_1060583706 27 Left 1060583696 9:124772526-124772548 CCCGTCCCTCACCTGCTACGAAA No data
Right 1060583706 9:124772576-124772598 CAACTGGACCTTACCAACCCTGG No data
1060583696_1060583705 11 Left 1060583696 9:124772526-124772548 CCCGTCCCTCACCTGCTACGAAA No data
Right 1060583705 9:124772560-124772582 TCTCTGCACTTGGGGGCAACTGG No data
1060583696_1060583704 4 Left 1060583696 9:124772526-124772548 CCCGTCCCTCACCTGCTACGAAA No data
Right 1060583704 9:124772553-124772575 CAACGCTTCTCTGCACTTGGGGG No data
1060583696_1060583702 2 Left 1060583696 9:124772526-124772548 CCCGTCCCTCACCTGCTACGAAA No data
Right 1060583702 9:124772551-124772573 TGCAACGCTTCTCTGCACTTGGG No data
1060583696_1060583701 1 Left 1060583696 9:124772526-124772548 CCCGTCCCTCACCTGCTACGAAA No data
Right 1060583701 9:124772550-124772572 TTGCAACGCTTCTCTGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060583696 Original CRISPR TTTCGTAGCAGGTGAGGGAC GGG (reversed) Intergenic
No off target data available for this crispr