ID: 1060587564 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:124795939-124795961 |
| Sequence | CTGGGGACAAGGACAGAGTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060587546_1060587564 | 29 | Left | 1060587546 | 9:124795887-124795909 | CCCTGGTCAGGGTGAATGTGCTA | 0: 1 1: 0 2: 0 3: 6 4: 90 |
||
| Right | 1060587564 | 9:124795939-124795961 | CTGGGGACAAGGACAGAGTTGGG | No data | ||||
| 1060587547_1060587564 | 28 | Left | 1060587547 | 9:124795888-124795910 | CCTGGTCAGGGTGAATGTGCTAT | 0: 1 1: 0 2: 1 3: 5 4: 82 |
||
| Right | 1060587564 | 9:124795939-124795961 | CTGGGGACAAGGACAGAGTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060587564 | Original CRISPR | CTGGGGACAAGGACAGAGTT GGG | Intronic | ||
| No off target data available for this crispr | |||||