ID: 1060587564

View in Genome Browser
Species Human (GRCh38)
Location 9:124795939-124795961
Sequence CTGGGGACAAGGACAGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060587546_1060587564 29 Left 1060587546 9:124795887-124795909 CCCTGGTCAGGGTGAATGTGCTA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1060587564 9:124795939-124795961 CTGGGGACAAGGACAGAGTTGGG No data
1060587547_1060587564 28 Left 1060587547 9:124795888-124795910 CCTGGTCAGGGTGAATGTGCTAT 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1060587564 9:124795939-124795961 CTGGGGACAAGGACAGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060587564 Original CRISPR CTGGGGACAAGGACAGAGTT GGG Intronic
No off target data available for this crispr