ID: 1060591081

View in Genome Browser
Species Human (GRCh38)
Location 9:124817357-124817379
Sequence ATGCCACTCCACCACTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060591078_1060591081 9 Left 1060591078 9:124817325-124817347 CCATAGACACACCAACCAGAAAC No data
Right 1060591081 9:124817357-124817379 ATGCCACTCCACCACTGCAGTGG No data
1060591080_1060591081 -6 Left 1060591080 9:124817340-124817362 CCAGAAACATAACAGCAATGCCA No data
Right 1060591081 9:124817357-124817379 ATGCCACTCCACCACTGCAGTGG No data
1060591077_1060591081 17 Left 1060591077 9:124817317-124817339 CCTGCTCTCCATAGACACACCAA No data
Right 1060591081 9:124817357-124817379 ATGCCACTCCACCACTGCAGTGG No data
1060591079_1060591081 -2 Left 1060591079 9:124817336-124817358 CCAACCAGAAACATAACAGCAAT No data
Right 1060591081 9:124817357-124817379 ATGCCACTCCACCACTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060591081 Original CRISPR ATGCCACTCCACCACTGCAG TGG Intergenic
No off target data available for this crispr