ID: 1060594630

View in Genome Browser
Species Human (GRCh38)
Location 9:124840710-124840732
Sequence GGATTCTCGAGTTCCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060594622_1060594630 23 Left 1060594622 9:124840664-124840686 CCACCGAACTGGCTGGTGACCCT No data
Right 1060594630 9:124840710-124840732 GGATTCTCGAGTTCCCCAGCTGG No data
1060594625_1060594630 4 Left 1060594625 9:124840683-124840705 CCCTCGTTTGGCGTCTCTTCCTC No data
Right 1060594630 9:124840710-124840732 GGATTCTCGAGTTCCCCAGCTGG No data
1060594626_1060594630 3 Left 1060594626 9:124840684-124840706 CCTCGTTTGGCGTCTCTTCCTCT No data
Right 1060594630 9:124840710-124840732 GGATTCTCGAGTTCCCCAGCTGG No data
1060594623_1060594630 20 Left 1060594623 9:124840667-124840689 CCGAACTGGCTGGTGACCCTCGT No data
Right 1060594630 9:124840710-124840732 GGATTCTCGAGTTCCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060594630 Original CRISPR GGATTCTCGAGTTCCCCAGC TGG Intergenic
No off target data available for this crispr