ID: 1060597375

View in Genome Browser
Species Human (GRCh38)
Location 9:124856522-124856544
Sequence GCGCCTGGTGGGAGACTGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060597375_1060597383 26 Left 1060597375 9:124856522-124856544 CCCAGCAGTCTCCCACCAGGCGC 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1060597383 9:124856571-124856593 TGCCTGTGCTATTCAGCATCCGG 0: 1
1: 0
2: 1
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060597375 Original CRISPR GCGCCTGGTGGGAGACTGCT GGG (reversed) Exonic
900882064 1:5389480-5389502 GTGCCTGGTGGGTGACGGTTAGG - Intergenic
901274989 1:7984186-7984208 GCTCCAGGTGGGAGAGTGATAGG + Intronic
901276677 1:7996944-7996966 GGGCCTGGTGGGAGACGTTTGGG - Intergenic
902711479 1:18242998-18243020 GCGCCTGATGGGAGTCAGATGGG - Intronic
902800109 1:18824255-18824277 GGGCCTGGTGGGAGATGGTTGGG - Intergenic
903691678 1:25178516-25178538 GGGCCTGGTGGGAGGTAGCTGGG - Intergenic
904865692 1:33577359-33577381 CCGCCTGGTGGGACACAGCATGG - Exonic
905891834 1:41522757-41522779 GCCCCCTGTGGGAAACTGCTTGG + Intronic
907192792 1:52662836-52662858 GCTACTGGAGGAAGACTGCTAGG + Intronic
908582063 1:65526081-65526103 GCGCCTGGAGCGAACCTGCTCGG + Intronic
908942213 1:69448948-69448970 GCGTCTGGAGTCAGACTGCTCGG - Intergenic
911548040 1:99244360-99244382 GCTCCTGCTGGGTGACTGGTAGG - Intergenic
911735395 1:101331343-101331365 GGGCCTGGTGGGAGATGACTGGG - Intergenic
916833551 1:168518081-168518103 GAGCCTGATGGGAGAGAGCTAGG + Intergenic
919019403 1:192084791-192084813 GCTCCTGGTCGGATTCTGCTGGG - Intergenic
920768500 1:208857060-208857082 GAGCCTGGTGGGAGAAGACTGGG - Intergenic
922706293 1:227792509-227792531 GCCTCTGGAGGGAGCCTGCTTGG - Intergenic
923466728 1:234254334-234254356 ATGCCTGGTGGGAGCCTTCTTGG - Intronic
924048163 1:240053423-240053445 TGACCTGGTGGGAGATTGCTGGG + Intronic
924907686 1:248473791-248473813 GCTCCTGGTGTCAGCCTGCTGGG + Exonic
924916422 1:248574295-248574317 GCTCCTGGTGTCAGCCTGCTGGG - Exonic
1065867029 10:29923182-29923204 GGGCCTGCTGGGACAGTGCTAGG + Intergenic
1067980116 10:51074749-51074771 GCGCCTGCTGGGTGGCTGGTCGG - Exonic
1068318856 10:55383186-55383208 GAGCCTGGCTGGAGACAGCTGGG - Intronic
1069733394 10:70634205-70634227 GGGCCAGGTGGCAGACGGCTGGG - Intergenic
1071560700 10:86644998-86645020 AGGCCTGGTGGGAAGCTGCTGGG - Intergenic
1074047275 10:109850470-109850492 GCACATGGTGGGAAACTGGTAGG + Intergenic
1074106299 10:110392088-110392110 GGGTCTGGTGGTAAACTGCTTGG + Intergenic
1074857655 10:117485329-117485351 GCACCTGGAAGGAGACTGCGGGG + Intergenic
1076741659 10:132488657-132488679 GCGCCTGGTCGTGGGCTGCTGGG + Intergenic
1076870120 10:133188884-133188906 GCACCTTGTGGGTGCCTGCTGGG + Intronic
1077141147 11:1025486-1025508 GCGCCTGCTGAGAGCCAGCTTGG + Intronic
1078505055 11:11932271-11932293 GGGCCTGGTGGGAGATGTCTGGG - Intronic
1081395928 11:42586215-42586237 GGGCCTGGTGGGAGATGGTTGGG - Intergenic
1081420970 11:42874298-42874320 GCGCATGGTGCGAGACTGGCAGG + Intergenic
1082793849 11:57365973-57365995 GCCCCTGGTGGGAGAGGCCTGGG + Intronic
1085063792 11:73473461-73473483 GCACCTGCTGGGTCACTGCTGGG + Intronic
1085264981 11:75231943-75231965 GCCCCTGGAGGGAGACTTCCTGG + Intergenic
1088889910 11:114036266-114036288 GCGCCGGGCGGGACCCTGCTGGG - Intergenic
1089528901 11:119113936-119113958 GCGCTTGGTGGGTGTCTTCTTGG - Exonic
1090428859 11:126629397-126629419 GGGCCAGCTGGGAGACTTCTGGG + Intronic
1092465560 12:8728734-8728756 GAGCATGGTGGCAGACTACTAGG - Intronic
1094408079 12:30140019-30140041 GGGCCTGGTGGGAGATGTCTGGG + Intergenic
1096451861 12:51749618-51749640 GCGCCACGTGGGAGGCTGCGTGG - Intronic
1096475832 12:51908166-51908188 GCGCCTAGGGTGAGACTCCTAGG - Intronic
1098287243 12:68919953-68919975 GAGCCTGGTGGGAGACGTTTGGG + Intronic
1102934039 12:116882015-116882037 GCGCCCGGTGGGAGGCTGGATGG + Intergenic
1103702335 12:122854455-122854477 GTGCCTGGCGGGAGATTCCTGGG - Intronic
1104400437 12:128471629-128471651 GATCCTGGGGTGAGACTGCTTGG + Intronic
1104829286 12:131737622-131737644 GTGTCTCGTGGGAGGCTGCTGGG + Intronic
1104976320 12:132553479-132553501 GCGTTTGGTGGGGGCCTGCTGGG + Intronic
1106289073 13:28343968-28343990 GCACCTGGTAGAAGACTTCTTGG - Intronic
1110401843 13:75101060-75101082 GGGCCTGGTGGGAGGTGGCTGGG - Intergenic
1113060892 13:106321797-106321819 GGGCCTGATGGGAGATTACTGGG + Intergenic
1125759316 15:42086116-42086138 CCACCTGTTGGGAGGCTGCTGGG - Intronic
1128115500 15:65102410-65102432 GAGCCCGGTTGGAGGCTGCTGGG + Exonic
1128815767 15:70607025-70607047 GCACCTGCTGGGAGAAAGCTAGG - Intergenic
1132227958 15:100157726-100157748 TGGCGTGGTGGCAGACTGCTTGG + Intronic
1132243251 15:100276369-100276391 GTGCCTGGTGGGAGAGTGGGAGG + Intronic
1132756738 16:1488928-1488950 GCGGCTGGAGGGAGACTGCTGGG - Intronic
1133339179 16:5025703-5025725 GCCCCAAGTGGGGGACTGCTGGG + Intronic
1144337214 17:14282222-14282244 CAGCCTGTTTGGAGACTGCTGGG + Intergenic
1147254878 17:39175530-39175552 CGGCCTGGTGGGTGGCTGCTGGG + Exonic
1147405666 17:40210173-40210195 ACACCAGTTGGGAGACTGCTAGG - Intergenic
1148739028 17:49881346-49881368 GACCCTGCTGGGAGAATGCTGGG - Intergenic
1149571385 17:57674964-57674986 GCGCCGGGTTGGAGCCTGCCGGG - Exonic
1152338349 17:79710261-79710283 GGGGCTGGTGGGTGAATGCTAGG - Intergenic
1152920048 17:83062080-83062102 GCCCCAGAGGGGAGACTGCTGGG - Intergenic
1159434245 18:68395356-68395378 GGGCCTGGTGGGAGATGTCTGGG - Intergenic
1160520944 18:79507589-79507611 GCGCCTGCTGAGACACTGCCAGG - Intronic
1160521053 18:79508249-79508271 GCGCCTGGTGGGAGGAAGCCTGG + Intronic
1160995655 19:1880953-1880975 GCGCCTGGTGGTTGCCTGCTGGG - Exonic
1163439372 19:17313942-17313964 GCACCTGCAGGGTGACTGCTGGG - Intronic
1163600167 19:18244224-18244246 GGGCCTGATGGGAGGCTCCTGGG + Intronic
1163685191 19:18708534-18708556 GAGCCTGGTGAGGGGCTGCTGGG + Intronic
1164676011 19:30102070-30102092 GGGCCTGGTGGGAGGCTTTTGGG - Intergenic
1164833129 19:31338336-31338358 AGGCCTGGTGGGGGTCTGCTGGG + Intronic
1164886608 19:31783733-31783755 GGGCCTGGTGGGAGACGGCAGGG - Intergenic
1165923679 19:39314312-39314334 GCACCTGATGGGCGGCTGCTGGG - Exonic
1168316283 19:55486101-55486123 GAGGCTGGAGGGAGGCTGCTGGG - Intronic
925246520 2:2388476-2388498 GGGCCTGGTGGGAGGGTGATTGG - Intergenic
925309787 2:2874472-2874494 GGGCCTGGAGGGAGACTTTTGGG - Intergenic
925662078 2:6213262-6213284 GAGGCTGGTGGGAGCTTGCTGGG - Intergenic
926304321 2:11627111-11627133 ATGCCTGGTGGGGAACTGCTGGG - Intronic
928199055 2:29235542-29235564 TGGCCTGGGGGGAGACTCCTGGG + Intronic
929501157 2:42493046-42493068 GCGCCTGGAGGGAGCCGCCTCGG + Exonic
931223676 2:60310686-60310708 GCGGCTGGTGGGAAATTGCCAGG - Intergenic
931700488 2:64905068-64905090 GCTCCTGCTCGGACACTGCTGGG + Intergenic
933370854 2:81413550-81413572 GGGCCTGGTGGGAGACGTTTGGG - Intergenic
935278468 2:101496516-101496538 GTGCCTGGAGAGAAACTGCTTGG - Intergenic
937263626 2:120602015-120602037 GAGCCTGCAGGGAGGCTGCTGGG - Intergenic
940879254 2:158929982-158930004 GAGCCTGGTGGGAGGCTCCCAGG + Intergenic
941933748 2:170967280-170967302 GGGCCTCCTGGGAGAGTGCTGGG - Intergenic
946179060 2:217939260-217939282 GAGTCTGGTGCCAGACTGCTGGG - Intronic
946372526 2:219289722-219289744 GCGCATGGTGGGAGGGTGGTGGG + Exonic
948450364 2:238066534-238066556 GACCCTGGTGGGGGCCTGCTAGG + Intronic
948586137 2:239020907-239020929 GCGGGTGTTGGGAGCCTGCTCGG + Intergenic
948806903 2:240456956-240456978 GGGCCTTGTGGGAGCCAGCTGGG - Intronic
1172445936 20:34993453-34993475 GCGCCTGCTGGGAGGCAGGTGGG + Exonic
1173345253 20:42193275-42193297 GCACCTTGTGGGAATCTGCTAGG + Intronic
1173487050 20:43448651-43448673 GCACCTGGTGGGAGACAATTGGG - Intergenic
1174535448 20:51247927-51247949 GTGCCAGGTGGGAGTCTGCATGG - Intergenic
1174630436 20:51952263-51952285 GGGCGTGGTGGGAGGCTACTTGG + Intergenic
1175212141 20:57366563-57366585 GGGCCTGGTGGGAGATGTCTGGG - Intronic
1175521031 20:59603121-59603143 GAAACTGGTGGGAAACTGCTAGG - Intronic
1175922589 20:62457124-62457146 GCTCCAAGTGGGAGACGGCTAGG - Intergenic
1175976871 20:62715280-62715302 GAGCCAGGTGGGAGACGGCAGGG + Intronic
1178465471 21:32843621-32843643 GCGCAGGGTTGGAGACTGCATGG - Intergenic
1178914120 21:36697620-36697642 GCCCCTGGAGGGAGCCTGCTCGG + Intergenic
1179918189 21:44491661-44491683 GGGCCTGTTGGGAGAGGGCTGGG - Intergenic
1180614654 22:17119699-17119721 GCGCCTGCTGGGCGGCTGCCTGG - Exonic
1182172515 22:28247141-28247163 GCGGCTGCTGGGTGCCTGCTAGG + Intronic
1183104976 22:35609202-35609224 GTGTCTGCTGGGAGACCGCTGGG + Intronic
1183588903 22:38768853-38768875 GGGCCTGCTGGGAGGGTGCTGGG - Intronic
1184852936 22:47131158-47131180 GGGCCTGGTGGGAGGCATCTGGG - Intronic
1185151354 22:49165318-49165340 GCTCCTGGGAGGAGACTGCAGGG + Intergenic
1185332190 22:50256796-50256818 GCCCCTGGTGGGAACCTGCCTGG - Intronic
950204782 3:11071194-11071216 GCGCGTGGTGCGGGACTGGTGGG - Intergenic
954758975 3:52860565-52860587 GCAGCTGGAGGGAGCCTGCTGGG - Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
966484705 3:180454809-180454831 GCGTCTGGTGGAAGACAGCTAGG - Intergenic
966790793 3:183667593-183667615 GGGGCTGGTGGGGGACTGGTCGG - Intronic
966989697 3:185217140-185217162 GAGCCTGGTGGGAGGTTACTGGG + Intronic
967147204 3:186616372-186616394 GTGCCTGGAGGGAGCCTGCCCGG + Intronic
967392659 3:188972537-188972559 TCGGCTGCCGGGAGACTGCTGGG - Intronic
967806097 3:193715758-193715780 GGGCCTGGTGGGAGATAGTTGGG + Intergenic
967884155 3:194322017-194322039 GGCCTTGGTGGGAGGCTGCTGGG + Intergenic
968426131 4:524629-524651 GAGCCTTGTGGGAGACGTCTGGG - Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969301964 4:6302350-6302372 CCGCCTGGTGGGTGAGAGCTGGG - Exonic
971301923 4:25449000-25449022 GCGCCTGGAGGGAAACAGCTGGG + Intergenic
972322274 4:37982983-37983005 GGGCCTGGAGCGAGACTGCTGGG + Intronic
972784634 4:42315326-42315348 GCGGCCGGTGGGCGCCTGCTGGG - Intergenic
981900627 4:149857818-149857840 GCGCCTGGTATGTGACTGATGGG + Intergenic
983747416 4:171219033-171219055 GGGCCTGGTGGGAGGTTGTTTGG + Intergenic
984841289 4:184070074-184070096 GGGCCTGGTGGGAGGCAACTGGG + Intergenic
985685002 5:1277333-1277355 GCGCCTGCTGTGAGCCTGCTGGG - Intronic
985824735 5:2183827-2183849 GGGCCTGCGGGGAGGCTGCTGGG + Intergenic
990362583 5:55035683-55035705 GAGCATGGTGGGAGATTGGTGGG + Intergenic
991065376 5:62418887-62418909 GCACCAGGTGTGAAACTGCTGGG + Exonic
991628771 5:68632733-68632755 GGGCCTGGGGTGAGACTCCTGGG + Intergenic
992802919 5:80309964-80309986 GCGCCTGGTGCGGGACTGGCGGG - Intergenic
992832836 5:80611784-80611806 GGGCCTGGTGGGAGATTTTTGGG - Intergenic
997691246 5:135828877-135828899 GTGCCAGGTGGGAGAATGCAAGG - Intergenic
998047309 5:138998753-138998775 GGGCCTGGTGGGAGAGTAATTGG - Intronic
998833445 5:146182704-146182726 GCGCCTGCTGGGTGTCTGCTCGG - Intergenic
1001051451 5:168417740-168417762 GGGCCTGGTAGGAGGGTGCTTGG + Intronic
1002644122 5:180644960-180644982 GTGCCCTTTGGGAGACTGCTGGG - Intronic
1007088255 6:39165971-39165993 GCTCCTGGTGGGGAATTGCTGGG + Intergenic
1011032162 6:82935352-82935374 GGGCCTGGTGGGAGGCTGTTTGG - Intronic
1013368240 6:109450305-109450327 GGGACTGGTGGGGGACTGCCTGG - Exonic
1013873447 6:114796007-114796029 GCTTCAGGTGGGAGACGGCTTGG + Intergenic
1013990765 6:116252141-116252163 GTGGCTGATGGGTGACTGCTAGG - Exonic
1016407603 6:143746692-143746714 GTGACAGGTGGGACACTGCTGGG - Intronic
1018379864 6:163248888-163248910 GCGTCTGTTGGGACACTACTCGG + Intronic
1019411941 7:910538-910560 ACGCCTGGCCCGAGACTGCTGGG + Intronic
1020809146 7:12830099-12830121 GGGCCTGGTGGGAGATGTCTGGG - Intergenic
1023820036 7:43975490-43975512 GCGGCTGGCGGGGGACTGCTGGG - Intergenic
1025249939 7:57344804-57344826 GGGCCTGGTGTGAGACTTCGGGG + Intergenic
1026069380 7:67104489-67104511 GGGCCTGGTGGGAGATGGCTGGG - Intronic
1026534625 7:71229622-71229644 GGGGCTGTTTGGAGACTGCTGGG - Intronic
1026707523 7:72707829-72707851 GGGCCTGGTGGGAGATGGCTGGG + Intronic
1029748315 7:102528943-102528965 GCGGCTGGCGGGGGACTGCTGGG - Intergenic
1029766262 7:102628030-102628052 GCGGCTGGCGGGGGACTGCTGGG - Intronic
1031957222 7:127954868-127954890 GGAACTGGTGGGAGACTTCTTGG - Intronic
1032721866 7:134556550-134556572 GTGCCTGGTAGGAGACTGAGGGG - Intronic
1034443148 7:151097762-151097784 GGGCCTGGTGGGAGGGTGTTTGG - Intronic
1034531463 7:151698438-151698460 GGGCCTGGTGGGAGAAGTCTGGG + Intronic
1035610750 8:962504-962526 GCGCCTTGAGGGAGCCTCCTGGG + Intergenic
1037334608 8:17780029-17780051 GGGCCTGGTGGGAGATGACTGGG + Intronic
1037542771 8:19888396-19888418 GGGCCTGGTGGGAAATTACTGGG - Intergenic
1041449857 8:57994824-57994846 GGGCCGGGAGAGAGACTGCTGGG + Intronic
1044706537 8:95014348-95014370 TCCTCTGGTGGGAGAATGCTTGG + Intronic
1047752150 8:127889993-127890015 CCTCCTGATGGGAGAGTGCTGGG + Intergenic
1049013754 8:139905593-139905615 GGGACTGGTGGGAGAATGGTAGG + Intronic
1049298343 8:141855708-141855730 GGGCCTGCAAGGAGACTGCTGGG + Intergenic
1055554508 9:77461127-77461149 GGGCCTGGTGAGAGCCTGCTGGG - Intronic
1056958642 9:91102423-91102445 GCCACTGGTGGAACACTGCTGGG + Intergenic
1057062693 9:92019814-92019836 GGGCCTCGTGGGAGAGTCCTGGG - Intergenic
1058566415 9:106289966-106289988 GCTCCTGGGGGGAGACTCCTGGG + Intergenic
1060187227 9:121571047-121571069 GGCCCTGGGGGGAGACAGCTTGG - Intronic
1060597375 9:124856522-124856544 GCGCCTGGTGGGAGACTGCTGGG - Exonic
1061013253 9:127967656-127967678 AGGCCTGCTGGGAGACTGGTGGG - Intronic
1062121508 9:134836398-134836420 GGGCCTGGTGGGAGGCGTCTGGG - Intronic
1062145783 9:134988968-134988990 GCGCCTGGTGGGAGGTGTCTAGG - Intergenic
1185913961 X:4014191-4014213 GGGCCTGGTGGGAGACGTTTGGG + Intergenic
1186877657 X:13832259-13832281 TCACCTGGTGTGAGGCTGCTGGG - Intronic
1189327014 X:40118805-40118827 GCCTCAGGTGGGAGGCTGCTTGG + Intronic
1192261363 X:69507405-69507427 GAGGCGGGAGGGAGACTGCTAGG - Intronic
1193142831 X:78046525-78046547 ACTCCTGGTGGGAGACTTCAGGG + Exonic
1194267917 X:91778369-91778391 CTGCCTGGTGGGCGACGGCTGGG - Intergenic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1200585123 Y:4999294-4999316 CTGCCTGGTGGGCGACGGCTGGG - Intergenic