ID: 1060598079

View in Genome Browser
Species Human (GRCh38)
Location 9:124860050-124860072
Sequence TAGCCTTCCCAATTTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060598079_1060598084 26 Left 1060598079 9:124860050-124860072 CCAGCAACAAATTGGGAAGGCTA 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1060598084 9:124860099-124860121 AAACCTCTTTACCATGTCCCCGG 0: 1
1: 0
2: 0
3: 18
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060598079 Original CRISPR TAGCCTTCCCAATTTGTTGC TGG (reversed) Intronic
901514382 1:9735178-9735200 GACCCTTCCCCATTTCTTGCTGG - Intronic
906798263 1:48714527-48714549 CAGCCTTCCACATTTCTTGCCGG + Intronic
907095725 1:51778733-51778755 TAGCCTTCCTGATTTTTTGGGGG - Intronic
907852034 1:58264528-58264550 TGGTTTTCCCAATTGGTTGCTGG + Intronic
917505470 1:175623435-175623457 TGGGCATCCCAATTTGTTGGAGG + Intronic
1069761018 10:70811504-70811526 TAGCCCTCTCACATTGTTGCTGG - Intergenic
1070693742 10:78546547-78546569 AAGTCTTTCCATTTTGTTGCAGG + Intergenic
1073912123 10:108358282-108358304 TAGCATGCCCAATGTGTTACTGG + Intergenic
1074731082 10:116376306-116376328 TACACTTCTCACTTTGTTGCTGG + Intronic
1077795196 11:5484233-5484255 CACCCTTCCTAACTTGTTGCAGG - Intronic
1080379220 11:31750220-31750242 TATTCTTCCAACTTTGTTGCTGG + Intronic
1080474432 11:32576406-32576428 TAGCCTTGCCAATTTCAGGCAGG + Intergenic
1081406743 11:42707272-42707294 TGGCCTTCCCAGTATGGTGCTGG - Intergenic
1083736184 11:64682646-64682668 TTGTCTTCCAAATTTGGTGCTGG + Intronic
1086247418 11:84770573-84770595 TATCCTTCACAAATTGATGCAGG - Intronic
1089613156 11:119680891-119680913 CAGCCTTCCCAACTCGTGGCTGG - Intronic
1091613409 12:2030884-2030906 TAATGTTCCCAACTTGTTGCTGG - Intronic
1097107369 12:56633652-56633674 TAGCCTTCCCAGATTGTAGAGGG - Intronic
1097153716 12:56997370-56997392 TGGCCTTCCCCATCTGGTGCCGG - Intergenic
1107784019 13:43936246-43936268 TAGGCATTCCAATTTGTTGGTGG - Intergenic
1108790862 13:53967768-53967790 TAGGCTCCCCATTTTCTTGCTGG + Intergenic
1116976077 14:51117430-51117452 TAGCCTTCCTAACTTGGAGCTGG + Intergenic
1121280396 14:92693322-92693344 TAACCTTCCAGGTTTGTTGCAGG + Intergenic
1122381923 14:101313864-101313886 AAACCTTCCCAGTTTGTTGGGGG + Intergenic
1122844143 14:104481546-104481568 GAGCCTGCCCAGCTTGTTGCTGG - Intronic
1127907011 15:63383261-63383283 GAACCTTCCCAAGTTGCTGCTGG - Intergenic
1128668081 15:69553188-69553210 CAGCCTGGCCACTTTGTTGCAGG + Intergenic
1129278920 15:74468288-74468310 TAGCCTTCCTAATTTTTATCTGG + Intergenic
1132198764 15:99933288-99933310 TGGCCTTGGCAATTTGGTGCAGG - Intergenic
1133534365 16:6686712-6686734 TAACCTTCCCATTATGTTTCAGG + Intronic
1133764663 16:8829554-8829576 GAGCCTTGCCAAGTTGATGCTGG - Intronic
1138375623 16:56562073-56562095 TTGACTTCTCAACTTGTTGCTGG - Intergenic
1144994835 17:19260366-19260388 TAGCCTTCCAAATGTGAAGCTGG + Intronic
1147942787 17:44061506-44061528 TAGCCTTCCAAATCTGTCCCTGG + Intronic
1149477313 17:56973975-56973997 GAGCCTTCCCAAATTGCTCCTGG - Intergenic
1149855039 17:60075073-60075095 TAGACTCCCCAATATCTTGCTGG - Intronic
1150601479 17:66654655-66654677 TAGCCTCCACAATTAATTGCAGG - Intronic
1151643624 17:75414622-75414644 TTGCCTTCCCAATCTTTAGCTGG + Intergenic
1152366767 17:79860872-79860894 AAGCCTTGTCATTTTGTTGCTGG + Intergenic
1159460722 18:68719608-68719630 TGGCCTCCCCAATTTGTTGGGGG - Intronic
1168142415 19:54397494-54397516 TAGCCTTACCAATTTTTTCCTGG - Intergenic
926250335 2:11152188-11152210 GAACCTTCCCAAATTGTTCCTGG - Intergenic
929120317 2:38478853-38478875 GAGCCTCCCCAAATTGTTCCTGG + Intergenic
931364475 2:61606866-61606888 TAGCCTTCCAAAGTTTTTGCTGG + Intergenic
934909589 2:98239002-98239024 TAACCTTACCAATTTGATGGGGG - Intronic
1173428564 20:42965104-42965126 TATCTTTCCAAATTTGTTGGTGG - Intronic
1177416075 21:20794898-20794920 TAACCTTCCCAATGGCTTGCAGG - Intergenic
1183910129 22:41072848-41072870 AAGCCTTCCCTATGTGTTCCAGG + Intergenic
949742770 3:7255237-7255259 TAGCCTTTCCAATTTGTAAAAGG - Intronic
952544947 3:34408819-34408841 TGGCCTGCCCAATTTGTGGGTGG + Intergenic
953092987 3:39748078-39748100 CAGCCTTCCATATTTGTTGCAGG - Intergenic
955020391 3:55115221-55115243 TAGCCTTCCAAAGTTCTTGCAGG - Intergenic
957023650 3:75153366-75153388 TTGCCTTCCGAATTTGTTCTTGG + Intergenic
958508022 3:95006669-95006691 TTGCATTACCAATTTGTTGTTGG - Intergenic
958873438 3:99588959-99588981 GGTGCTTCCCAATTTGTTGCAGG - Intergenic
959157330 3:102682687-102682709 GACCCTCCCCAAATTGTTGCTGG + Intergenic
960112907 3:113862874-113862896 TGGCATTCCCATTGTGTTGCAGG - Intronic
963701036 3:148626983-148627005 CAGCCTTGACAATTTGTTCCTGG - Intergenic
970427065 4:15955204-15955226 CAGAATTCCCAATGTGTTGCAGG - Intergenic
983714824 4:170767757-170767779 TAGCCTTCCAAATGTTTTGTCGG - Intergenic
986609477 5:9552239-9552261 TATCTTTCCCACTTTCTTGCTGG - Intergenic
986767151 5:10938610-10938632 TATCATACCCAATTTGTGGCTGG + Intergenic
991993338 5:72363028-72363050 TTGCCTACCCAAATTGTAGCAGG - Intergenic
997370788 5:133358358-133358380 CAGCCTTCCCAGGTTGATGCTGG - Intronic
1000400918 5:160826283-160826305 AAGCATTCCCTTTTTGTTGCGGG + Intronic
1005714228 6:28531835-28531857 TTGCTTTCCAAATTGGTTGCAGG - Exonic
1010617244 6:78029052-78029074 TACCCTCTCCAATCTGTTGCTGG - Intergenic
1017095768 6:150804084-150804106 TTGTCTTACCATTTTGTTGCAGG + Intronic
1024389964 7:48797664-48797686 TTGCCTTTCCATTTTGTTGATGG + Intergenic
1027187336 7:75980258-75980280 TGGCCTTCCCCATCTGGTGCGGG + Intronic
1028329626 7:89573329-89573351 TTGACTTCCTAAGTTGTTGCAGG + Intergenic
1029874825 7:103739365-103739387 TTTCCTTCCCATTTTGTTGGGGG + Intronic
1031133229 7:117857832-117857854 TCTCCTTCCCAATTTCTTTCTGG + Intronic
1031464040 7:122086097-122086119 TAGCCTTCCAAATTTAATCCTGG + Exonic
1037009785 8:13826775-13826797 TAGTCTTACCAATTTTTTTCGGG - Intergenic
1039731987 8:40289963-40289985 TAGGCTGCCAAATTTGTTTCAGG + Intergenic
1041327548 8:56684905-56684927 TTGCCTTGCCATTTTGTTCCAGG - Intergenic
1043439411 8:80263651-80263673 TAGCCTTCCAAATGTGTCCCAGG - Intergenic
1045545425 8:103124041-103124063 TTGCCTCCACAATTTATTGCTGG + Intergenic
1045610086 8:103829582-103829604 TATCCTAACCAATTTGATGCAGG + Intronic
1048203732 8:132399047-132399069 AAGCCTTCCTATTTTGTTGGTGG - Intronic
1051536257 9:18161679-18161701 AAGCCTTCCCCACTTCTTGCTGG - Intergenic
1052118706 9:24681393-24681415 TACCTTGCCCAATTTTTTGCAGG + Intergenic
1056074115 9:83020742-83020764 ATGCCTCCCAAATTTGTTGCTGG - Intronic
1058355942 9:104083554-104083576 GAGCCTTCCCAGTTTGATACTGG - Intergenic
1058852958 9:109030682-109030704 GGGCCTTCCCAATTTGGTGGTGG - Intronic
1060315799 9:122509354-122509376 TAGCCTTCACAGTTTGTTATGGG + Intergenic
1060598079 9:124860050-124860072 TAGCCTTCCCAATTTGTTGCTGG - Intronic
1061981764 9:134109169-134109191 TAGCCTTCCAAAAATGTTGCTGG - Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1193453724 X:81702793-81702815 TATGCTACCCAAGTTGTTGCTGG + Intergenic
1193468204 X:81871790-81871812 AAGCCCTCCCACTTTGTTGATGG - Intergenic
1194109972 X:89821697-89821719 TAGCCTTCCCAAATTGGTTTTGG - Intergenic
1201596143 Y:15671661-15671683 TATCCTTCGCCATTTGTTGACGG + Intergenic