ID: 1060601768

View in Genome Browser
Species Human (GRCh38)
Location 9:124882810-124882832
Sequence GGCACTCATGTCAACACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060601768_1060601775 3 Left 1060601768 9:124882810-124882832 CCCTCTGTGTTGACATGAGTGCC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1060601775 9:124882836-124882858 GCGCTGCCTATCCCTTCCCGGGG No data
1060601768_1060601773 1 Left 1060601768 9:124882810-124882832 CCCTCTGTGTTGACATGAGTGCC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1060601773 9:124882834-124882856 CAGCGCTGCCTATCCCTTCCCGG No data
1060601768_1060601778 9 Left 1060601768 9:124882810-124882832 CCCTCTGTGTTGACATGAGTGCC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1060601778 9:124882842-124882864 CCTATCCCTTCCCGGGGGCTTGG No data
1060601768_1060601774 2 Left 1060601768 9:124882810-124882832 CCCTCTGTGTTGACATGAGTGCC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1060601774 9:124882835-124882857 AGCGCTGCCTATCCCTTCCCGGG No data
1060601768_1060601776 4 Left 1060601768 9:124882810-124882832 CCCTCTGTGTTGACATGAGTGCC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1060601776 9:124882837-124882859 CGCTGCCTATCCCTTCCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060601768 Original CRISPR GGCACTCATGTCAACACAGA GGG (reversed) Intronic
900256050 1:1698791-1698813 GCCGCTCATCTGAACACAGAAGG - Intronic
900264718 1:1751401-1751423 GCCGCTCATCTGAACACAGAAGG - Exonic
903654615 1:24941758-24941780 GGGACTCAGGTCATCACACAGGG - Intronic
909613821 1:77583427-77583449 GGGCCTCATTTTAACACAGAAGG + Intronic
909868504 1:80706641-80706663 AGAAATCATGTGAACACAGAGGG - Intergenic
910078593 1:83311115-83311137 AGAACTCATTTCATCACAGATGG + Intergenic
915897967 1:159826113-159826135 AGCACTGAGGGCAACACAGAAGG + Intergenic
916455226 1:164964216-164964238 AGCAGTCAGGTCAACAGAGAAGG + Intergenic
919446048 1:197707099-197707121 GTCATTCATGGCAACACAGATGG + Intronic
921796728 1:219353329-219353351 GGCATTCAAGTAAACACTGAAGG - Intergenic
923036517 1:230288426-230288448 GGCACCCATTTCATCACACAAGG + Intergenic
1064408727 10:15087358-15087380 GGCACACATTTGAACCCAGATGG + Intronic
1064866866 10:19890440-19890462 GGAACTCATGGAAATACAGATGG - Intronic
1067841853 10:49687469-49687491 GGCTCTGAAGTCAACACATATGG + Intronic
1067990254 10:51204061-51204083 GGTACTAAAGTCAAAACAGATGG - Intronic
1069145358 10:64886368-64886390 GGCATTCATGGCAACCTAGATGG - Intergenic
1073077097 10:100830935-100830957 CACACTCTTGTCAACACAAAGGG + Intergenic
1074217304 10:111398195-111398217 CACACACATGTCAACACAGAGGG - Intergenic
1076930732 10:133530047-133530069 GGAATTCACATCAACACAGATGG + Intronic
1081071200 11:38610959-38610981 GGAACTCATGTTAAACCAGAAGG - Intergenic
1083028737 11:59572788-59572810 GGCCCTCATGTCTACAAAGTTGG - Intergenic
1083768412 11:64853273-64853295 GGCTCTCATGTCCAGACAGCGGG - Exonic
1084967928 11:72753977-72753999 GACACTCCTGTCATCCCAGAAGG - Intronic
1084975140 11:72792958-72792980 GGTGCTCATCTCAACACAGCAGG + Exonic
1086186574 11:84024594-84024616 GTCATTCATGACAACATAGATGG + Intronic
1089945818 11:122472263-122472285 GGCACTCACACCAACACATAGGG + Intergenic
1092005265 12:5064069-5064091 GTCCCTCATTTCATCACAGAAGG - Intergenic
1094450538 12:30578817-30578839 AGCACTCTTTTCAACACAGCAGG - Intergenic
1094807504 12:34107281-34107303 GGAACTCATGTCACCCCAAACGG - Intergenic
1095911941 12:47436600-47436622 GTCATTTATGGCAACACAGATGG + Intergenic
1097956332 12:65489354-65489376 TGCACTCATGCCAAGAAAGAAGG - Intergenic
1100857935 12:98774837-98774859 TGCATTAATGTCAACACAAAAGG - Intronic
1104843812 12:131836929-131836951 GGCACCCAGGTCCCCACAGATGG + Intronic
1105637045 13:22225649-22225671 AGCACTCATTTCCCCACAGACGG + Intergenic
1107914218 13:45132795-45132817 GGAAGTCAGGTCAGCACAGAGGG + Intronic
1108200979 13:48042740-48042762 TGCACTCAATTCAACATAGAGGG - Intronic
1109725285 13:66332571-66332593 GGCACACAAGTCAATAGAGAAGG + Intronic
1112313937 13:98344413-98344435 GGCACTACTGTCCACCCAGATGG - Intronic
1112368523 13:98775038-98775060 GGTACTCAGGACACCACAGAGGG + Intergenic
1112918663 13:104582245-104582267 GGCACTCATGTTCATAAAGATGG - Intergenic
1114433108 14:22679285-22679307 GGTACTTATCTCAACACAGGGGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1115264708 14:31489029-31489051 GACACTGAGGTCAGCACAGAAGG - Intergenic
1115400233 14:32950162-32950184 GACAATCATCTCAACACAGTGGG + Intronic
1119678560 14:76574721-76574743 GGCACCCATGTCAGCACAGAGGG + Intergenic
1120097006 14:80400699-80400721 GAAACTAATGTCAACAGAGAAGG + Intergenic
1120944188 14:89978213-89978235 GGCACTCCTTTCACCACACATGG - Intronic
1125774741 15:42202125-42202147 GGCACCCATGTCAAAAAAAATGG + Intronic
1127145641 15:56020206-56020228 GGTACTCATGGACACACAGATGG - Intergenic
1128379854 15:67104586-67104608 GGCACTCATGGGAAAACAGCTGG - Intronic
1130294834 15:82638977-82638999 GGTACAAATGTCAACACAGTGGG + Intronic
1134516649 16:14892936-14892958 GGCAGTCACATCAACAAAGAAGG - Intronic
1134704318 16:16291589-16291611 GGCAGTCACATCAACAAAGAAGG - Intronic
1134963225 16:18420525-18420547 GGCAGTCACATCAACAAAGAAGG + Intronic
1134967520 16:18503124-18503146 GGCAGTCACATCAACAAAGAAGG + Intronic
1136503996 16:30690882-30690904 GGGACTGCTGTCAACCCAGAGGG - Intergenic
1137302165 16:47161640-47161662 GGCACTCATGGGAACACAGCAGG + Intronic
1137719753 16:50621193-50621215 GGCCAAAATGTCAACACAGAAGG + Intronic
1137901234 16:52271557-52271579 GGCAGTGATGACATCACAGAAGG + Intergenic
1140879569 16:79185699-79185721 TGCTCTCAAGACAACACAGAAGG - Intronic
1142124843 16:88405144-88405166 GGAACAGATGTCCACACAGAGGG + Intergenic
1145760755 17:27424457-27424479 AGGACTCATGTCATCAGAGAGGG - Intergenic
1145771076 17:27493662-27493684 TACACTCACGACAACACAGAAGG - Intronic
1153700636 18:7689728-7689750 GGCAGTCATGTCAACAGACAAGG - Intronic
1153885563 18:9461768-9461790 GTCAATCATGTAAACACTGAAGG + Intergenic
1155090451 18:22504149-22504171 GCCACTCATCACAACAGAGAGGG - Intergenic
1160414677 18:78700158-78700180 GGCATACATGTTAACACATATGG - Intergenic
1165119873 19:33552142-33552164 GCCACTCATGCCACTACAGAGGG + Intergenic
1166305625 19:41935565-41935587 GGCACTCATGGAGAGACAGACGG + Intergenic
1167593447 19:50416195-50416217 GGCTCTCAGGTCACCACGGAAGG - Intronic
927781551 2:25943340-25943362 GTCCCTCATTTCACCACAGAAGG - Intronic
929730322 2:44484061-44484083 GGCACTCATTTCTGCAAAGAAGG - Intronic
931506004 2:62927030-62927052 GCCATTCATGGCAATACAGATGG + Intronic
938982265 2:136537993-136538015 GGGACTGAGGTGAACACAGAGGG + Intergenic
939610341 2:144302122-144302144 GGCACTCATCTCCACACTTAGGG + Intronic
940902087 2:159134863-159134885 TGCACTTAGGCCAACACAGAAGG - Intronic
941117273 2:161486741-161486763 GTTACTCATGACAACATAGATGG + Intronic
942533193 2:176934831-176934853 GGCACTCATGTTAATAAAGATGG - Intergenic
944302036 2:198134529-198134551 GGAACTCATGCCAGCATAGAAGG + Intronic
944784930 2:203059937-203059959 GGCATACATGTCAAAACAGGGGG - Intronic
947148765 2:227092964-227092986 GGCAATCATTTCAACACATGTGG - Intronic
947437536 2:230085413-230085435 GTCATTCATTTCAACACACAGGG + Intergenic
1170414362 20:16124294-16124316 GGCACACATGGGAACACAGTGGG + Intergenic
1173009313 20:39167224-39167246 TGCACTGATCTTAACACAGATGG - Intergenic
1174502641 20:50996900-50996922 GGGAGTTATGACAACACAGAAGG + Intergenic
1176797095 21:13379106-13379128 GGCACTCCTCACAACCCAGATGG - Intergenic
1180744936 22:18081091-18081113 GTCATTCATGACAACACAGGTGG - Intronic
1183817493 22:40315551-40315573 GGGGCTTATGTTAACACAGATGG + Intronic
1184177684 22:42798451-42798473 GCCACTCATATCGTCACAGATGG + Intronic
949876861 3:8631947-8631969 GGCACTCATCTCAAATAAGATGG - Intronic
952720129 3:36523949-36523971 GCCACTAAGGGCAACACAGAAGG + Intronic
952753378 3:36843891-36843913 GGCACTCATAGCAGCACATACGG - Intronic
954111058 3:48433401-48433423 TGCACTTATGTCTACACAAAGGG + Intronic
954680051 3:52340522-52340544 GAGAATCATTTCAACACAGAGGG - Intronic
955012245 3:55029466-55029488 TGCATCCCTGTCAACACAGATGG - Intronic
955843192 3:63133413-63133435 GGCAAACATGAAAACACAGAAGG + Intergenic
955919105 3:63936315-63936337 GTCACTGATGTTAGCACAGATGG - Intronic
956361544 3:68453207-68453229 GGCTCTCTTGTCAAGACAGAGGG - Intronic
960540770 3:118859905-118859927 GGCATTTGTGACAACACAGATGG - Intergenic
964144078 3:153437475-153437497 GGCACTCATGTTAAGAGAAAAGG - Intergenic
970463792 4:16302855-16302877 AGCACTCATGTGAACTCTGAAGG - Intergenic
972532749 4:39976521-39976543 GGCACTCACGACGCCACAGAGGG + Exonic
974204016 4:58675647-58675669 GGAACAGATCTCAACACAGAAGG - Intergenic
977409640 4:96645445-96645467 GGTACTCATGTCTATAAAGATGG - Intergenic
978206014 4:106082388-106082410 GGTACTCATGGACACACAGAAGG + Intronic
980634871 4:135488699-135488721 GGGAATCATGTGAACCCAGAAGG + Intergenic
981197455 4:141938264-141938286 GGCCATGATGTCCACACAGAAGG - Intergenic
983901575 4:173141458-173141480 ATCACATATGTCAACACAGATGG - Intergenic
984462557 4:180056990-180057012 GGCATAGATGTCATCACAGACGG + Intergenic
985691335 5:1314393-1314415 GGGACTGATGTAACCACAGAGGG + Intergenic
991943550 5:71878279-71878301 GTCATTCATGGCAACATAGATGG - Intergenic
991988462 5:72314170-72314192 GGCAATTATTTCAACACACATGG + Intronic
992896671 5:81251899-81251921 GGCTTTCATTTCATCACAGAAGG - Intronic
992989064 5:82264868-82264890 CACACTAATGTCACCACAGAAGG - Intronic
995865023 5:116681418-116681440 TGCACTAATGGCCACACAGAGGG + Intergenic
998005809 5:138656167-138656189 GGCCCTCATGAGATCACAGATGG + Intronic
998536592 5:142938054-142938076 TGAACTCATGTCAAAACTGATGG + Intronic
1001954722 5:175841296-175841318 AGAACTCATGCCCACACAGAAGG + Intronic
1004553716 6:16674774-16674796 GGCTCTGATGGCAAAACAGATGG + Intronic
1010609305 6:77933698-77933720 GGCACTCATAGGAACAAAGAAGG - Intergenic
1011589579 6:88959048-88959070 GGCATTCATGGCAACCTAGATGG + Intronic
1011848523 6:91596659-91596681 GGTACTGCTGTCAACTCAGAGGG + Intergenic
1013325965 6:109046738-109046760 GGCACTCCTCACAACCCAGATGG - Intronic
1017646829 6:156547155-156547177 GACAATCATGAAAACACAGAAGG + Intergenic
1018852348 6:167649743-167649765 GATACTCAGCTCAACACAGAAGG + Intergenic
1019147369 6:169983956-169983978 GGAGCTCAGGTCAACACAGAGGG - Intergenic
1019163640 6:170085158-170085180 AGAACTCATGTCACCCCAGAAGG + Intergenic
1020386269 7:7606191-7606213 GTCACTCATGTTAACAAAGGTGG + Intronic
1020807114 7:12803797-12803819 GACACATATGTGAACACAGACGG + Intergenic
1021139083 7:17001608-17001630 CTCATTCATGGCAACACAGATGG - Intergenic
1024473358 7:49786173-49786195 GGCACTTATGTACACAAAGATGG - Intronic
1024544830 7:50508452-50508474 GGCACTTACGTGAGCACAGAGGG - Intronic
1024960229 7:54966803-54966825 AGCTCTCATGTAAACCCAGATGG - Intergenic
1027460866 7:78451744-78451766 GGCACTTTTGGCAACACTGATGG + Intronic
1029605331 7:101595562-101595584 GCCACTTATTGCAACACAGATGG + Intergenic
1029712217 7:102306040-102306062 GGCACTCATGCCACCACACTCGG + Intronic
1029820219 7:103139587-103139609 GGCGCTGATGGCAACAGAGAGGG + Intronic
1029848031 7:103433415-103433437 GGCACTTCTAGCAACACAGAGGG - Intronic
1033155417 7:138952542-138952564 GTCACTCATCTCTACACAGTAGG + Intronic
1035730286 8:1849624-1849646 GGCAGTCGTGTGGACACAGACGG + Intronic
1044846197 8:96384448-96384470 GTCAATCAAGTCAACACAGCAGG - Intergenic
1049876865 8:145029451-145029473 GGGACTCATGTTAACCCACAGGG + Intergenic
1050358255 9:4803869-4803891 GGCACTATTGCCAACACACAGGG - Intronic
1051145151 9:14019406-14019428 GGCACACATGGAAACAAAGAGGG - Intergenic
1051200677 9:14618958-14618980 GCCAATCATGTCTAAACAGATGG - Exonic
1052101943 9:24458266-24458288 GGCACTGGAGTCAACAGAGATGG + Intergenic
1055831590 9:80385686-80385708 GGAACTCATATCAACACTGATGG + Intergenic
1055876850 9:80953711-80953733 GGCTCTCATGGCAACTCACAAGG + Intergenic
1057044201 9:91872270-91872292 GCCACTCATGTAAACACACTCGG + Intronic
1060601768 9:124882810-124882832 GGCACTCATGTCAACACAGAGGG - Intronic
1061553342 9:131350452-131350474 GGGCCTCATGGCTACACAGAGGG - Intergenic
1062033341 9:134371911-134371933 GGCACTTATTTCAACACCGCTGG - Intronic
1062325754 9:136011720-136011742 GGCACTCAGGTCAACATTCACGG + Exonic
1196762469 X:119211862-119211884 GACACTGCTGTCAACACTGAGGG + Intergenic
1197826321 X:130594204-130594226 GGCACTCATCCCAACAGAAAAGG + Intergenic
1202028746 Y:20551675-20551697 GGCACTCCTCACATCACAGATGG - Intergenic