ID: 1060603763

View in Genome Browser
Species Human (GRCh38)
Location 9:124896121-124896143
Sequence GCTCCATCTCAGGCAGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060603758_1060603763 -9 Left 1060603758 9:124896107-124896129 CCTAAGTCCTAAAAGCTCCATCT 0: 1
1: 0
2: 1
3: 7
4: 175
Right 1060603763 9:124896121-124896143 GCTCCATCTCAGGCAGGGCATGG No data
1060603756_1060603763 28 Left 1060603756 9:124896070-124896092 CCTAGGTGTCATCTACAATTCCT 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1060603763 9:124896121-124896143 GCTCCATCTCAGGCAGGGCATGG No data
1060603757_1060603763 8 Left 1060603757 9:124896090-124896112 CCTATTTTTTTCTCATTCCTAAG 0: 1
1: 0
2: 6
3: 72
4: 669
Right 1060603763 9:124896121-124896143 GCTCCATCTCAGGCAGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060603763 Original CRISPR GCTCCATCTCAGGCAGGGCA TGG Intronic
No off target data available for this crispr