ID: 1060610538

View in Genome Browser
Species Human (GRCh38)
Location 9:124960349-124960371
Sequence TGTAATCTGAATACTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11713
Summary {0: 1, 1: 3, 2: 84, 3: 1050, 4: 10575}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060610538_1060610541 -1 Left 1060610538 9:124960349-124960371 CCTCCTGAAGTATTCAGATTACA 0: 1
1: 3
2: 84
3: 1050
4: 10575
Right 1060610541 9:124960371-124960393 AGACAGGAGCCACCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060610538 Original CRISPR TGTAATCTGAATACTTCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr