ID: 1060610541

View in Genome Browser
Species Human (GRCh38)
Location 9:124960371-124960393
Sequence AGACAGGAGCCACCATGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060610536_1060610541 10 Left 1060610536 9:124960338-124960360 CCCAGCTTTGGCCTCCTGAAGTA 0: 1
1: 1
2: 6
3: 61
4: 605
Right 1060610541 9:124960371-124960393 AGACAGGAGCCACCATGCCCTGG No data
1060610538_1060610541 -1 Left 1060610538 9:124960349-124960371 CCTCCTGAAGTATTCAGATTACA 0: 1
1: 3
2: 84
3: 1050
4: 10575
Right 1060610541 9:124960371-124960393 AGACAGGAGCCACCATGCCCTGG No data
1060610535_1060610541 11 Left 1060610535 9:124960337-124960359 CCCCAGCTTTGGCCTCCTGAAGT 0: 1
1: 0
2: 26
3: 278
4: 1933
Right 1060610541 9:124960371-124960393 AGACAGGAGCCACCATGCCCTGG No data
1060610537_1060610541 9 Left 1060610537 9:124960339-124960361 CCAGCTTTGGCCTCCTGAAGTAT 0: 2
1: 14
2: 197
3: 2198
4: 18298
Right 1060610541 9:124960371-124960393 AGACAGGAGCCACCATGCCCTGG No data
1060610539_1060610541 -4 Left 1060610539 9:124960352-124960374 CCTGAAGTATTCAGATTACAGAC 0: 1
1: 0
2: 17
3: 539
4: 7521
Right 1060610541 9:124960371-124960393 AGACAGGAGCCACCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060610541 Original CRISPR AGACAGGAGCCACCATGCCC TGG Intronic
No off target data available for this crispr