ID: 1060611875

View in Genome Browser
Species Human (GRCh38)
Location 9:124973939-124973961
Sequence AAGAACATGGAGAACTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060611875 Original CRISPR AAGAACATGGAGAACTAGAT GGG (reversed) Intronic
900291261 1:1924477-1924499 AGGTGCATGGAGAACTTGATGGG + Exonic
901973533 1:12926880-12926902 CAGAACATGGAGCACTGAATGGG - Intronic
902213183 1:14918202-14918224 CAGAATAGGGAGAACAAGATGGG + Intronic
903865195 1:26392730-26392752 AAGGACATGGAGGAGTAGAGAGG + Intergenic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
906424056 1:45694877-45694899 AAAAAGATGTAGAACTAGATAGG - Intronic
906540014 1:46578190-46578212 CAGAACATGGACAACTATCTGGG + Intronic
906627992 1:47341217-47341239 AAGAACATTGAGAAAGAGATGGG - Intronic
906995551 1:50789804-50789826 AAGAAGATGGAAAGCTAGGTAGG - Intronic
908278341 1:62500874-62500896 AAGAACTTGGAAAACTGGCTGGG + Intronic
910012345 1:82480983-82481005 AGGAACAAGGAGGACTAGAGTGG + Intergenic
910450827 1:87342958-87342980 AAAAATATGGAGAACGAGAGAGG - Intronic
910700065 1:90063805-90063827 AAGAAAATGGAGAACTTGGAGGG + Intergenic
910744486 1:90558470-90558492 GAGAACCTGGAGCATTAGATGGG - Intergenic
910999285 1:93145464-93145486 AAGAACATTAAGACATAGATTGG + Intergenic
911318557 1:96384167-96384189 AAAAACAAGGATAAATAGATGGG + Intergenic
911413035 1:97534750-97534772 AAAAAAATGGAGAACTATACTGG - Intronic
912740045 1:112186192-112186214 AAGAACAGGGAGCACAAGTTAGG + Intergenic
913577265 1:120189317-120189339 AAATACATGGAGAACTGGCTGGG + Intergenic
913678401 1:121164680-121164702 GAGAACTTGAAGAACTACATGGG + Intergenic
914030239 1:143952318-143952340 GAGAACTTGAAGAACTACATGGG + Intronic
914159211 1:145115633-145115655 GAGAACTTGAAGAACTACATGGG - Intergenic
914559178 1:148800744-148800766 AAATACATGGAGAACTGGCTGGG + Intergenic
914613655 1:149329479-149329501 AAATACATGGAGAACTGGCTGGG - Intergenic
915802318 1:158807688-158807710 AAGAAGGTGGAAAACTAGGTTGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916695039 1:167226096-167226118 AAGAACATGGATAACCAAAAGGG - Intronic
916782375 1:168049052-168049074 AAGAACATGGAACAGTAAATGGG + Intronic
917181364 1:172301799-172301821 AAGATAATAGAGAACTAGAGAGG + Intronic
919348221 1:196414740-196414762 AAAATCATGGAGAATTACATGGG - Intronic
919545555 1:198913538-198913560 ATGAACACGGAGAACTTGCTAGG + Intergenic
920465706 1:206183204-206183226 GAGAACTTGAAGAACTACATGGG + Intergenic
921623560 1:217353356-217353378 TAGAAGATGGGGAACTAGTTAGG - Intergenic
922157421 1:223051350-223051372 AACAACCTGGAGAGCCAGATTGG + Intergenic
922272893 1:224050834-224050856 CAGAACAAGGAGGACCAGATGGG + Intergenic
922588448 1:226753697-226753719 GAGAACATGGAGAACAATACAGG + Intergenic
922644464 1:227272905-227272927 AAAGAAATGGAGAATTAGATAGG - Intronic
924143815 1:241053178-241053200 AAGAACAAGAAGAGCTGGATAGG - Intronic
924262966 1:242251054-242251076 AAGAACATGGAGGGCCAGGTGGG + Intronic
924375895 1:243408493-243408515 AAGAAGAAGGAGAACTAGCTTGG + Intronic
924756273 1:246944137-246944159 ATCAACATGGATAATTAGATAGG + Intergenic
1062954022 10:1528597-1528619 AAAACCATGGAGAACTTGAGAGG - Intronic
1063246460 10:4224777-4224799 AATAACATGTAAAACAAGATCGG + Intergenic
1063915108 10:10873767-10873789 AGGGACAGGGAGAACTGGATAGG - Intergenic
1066721815 10:38347395-38347417 AAGAACATGGAGGGCCAGGTGGG - Intergenic
1067993591 10:51243490-51243512 AAGAACATGGGGAACTAGGTAGG - Intronic
1069218278 10:65850457-65850479 AAAAACAAGGAGAAAAAGATGGG + Intergenic
1071054742 10:81496129-81496151 AAGAACTTGGAGACTTTGATGGG - Intergenic
1072172331 10:92877455-92877477 AAGAACCTGGAGAAGTATAAAGG - Intronic
1072249472 10:93570101-93570123 AAGAAGATGGAGAGCCAGAAAGG - Intronic
1072266296 10:93731226-93731248 TAGAAACTGGAGAACCAGATGGG + Intergenic
1073937520 10:108651306-108651328 AAGAAGATGGAGAAATAAACAGG - Intergenic
1074522038 10:114234804-114234826 AAGAACAAGGAGAACAAAGTTGG - Intergenic
1078116530 11:8457924-8457946 AATAACATGGAGAACTTGGTAGG + Intronic
1079155136 11:17939195-17939217 CAGAACAAGGAGAACAAGAGGGG + Intronic
1079325478 11:19487474-19487496 AAGAACATGGTGACAGAGATGGG + Intronic
1079512417 11:21226914-21226936 AACAACATGAAAAACTAGAGAGG + Intronic
1080418127 11:32088674-32088696 AGGAACAGGGAGAAAAAGATTGG - Intronic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1080956456 11:37102089-37102111 AGGAACAAGGAGAACTACATTGG - Intergenic
1080986246 11:37469881-37469903 AAGAATATGTAGGACAAGATGGG - Intergenic
1081254470 11:40875479-40875501 GGGAACGTTGAGAACTAGATAGG - Intronic
1081435095 11:43018880-43018902 TAAAAGATGGAGAACTGGATCGG - Intergenic
1081955124 11:47085366-47085388 AAGAACAAGGAGGCCTAGGTGGG + Intronic
1082204492 11:49416114-49416136 AAGAACATATAAAACTAAATTGG + Intergenic
1082881755 11:58044860-58044882 AATAAAATGGAGATATAGATGGG + Intronic
1085467409 11:76733668-76733690 TAGTAGATGGAAAACTAGATGGG + Intergenic
1085673394 11:78490947-78490969 AAAAACATTGAGGAATAGATAGG - Intronic
1085998038 11:81945909-81945931 AAGAAAAAGTAGAACCAGATTGG - Intergenic
1087530490 11:99375004-99375026 AAGAAAATGGAGAGCTAGGCCGG + Intronic
1087951013 11:104220330-104220352 AAGAAGGTGGAAAACTAGACTGG + Intergenic
1088204713 11:107378885-107378907 AGGAACAAAGAGAAGTAGATTGG + Intronic
1088902789 11:114131077-114131099 CAGGAGATGGAGAACTAGCTTGG + Intronic
1091318548 11:134633104-134633126 AAGAAAAAGGAGACCCAGATTGG - Intergenic
1091888490 12:4033565-4033587 AAGAAAAACGAGAACCAGATTGG + Intergenic
1091992277 12:4965046-4965068 AAGAGCATGGAGACATAAATCGG - Intergenic
1092623639 12:10301935-10301957 GAGAAGAGGGAGAACGAGATGGG + Intergenic
1092920195 12:13224250-13224272 AAGAAGGTGGAGAAATAGTTGGG + Intergenic
1093867302 12:24244187-24244209 AATTACATGGAAAACCAGATAGG - Intergenic
1094281224 12:28740834-28740856 AAGAACATGAAGAATCAGATAGG - Intergenic
1095963167 12:47848373-47848395 AACAAAATGGAGAATTAGAAGGG - Intronic
1096945004 12:55395120-55395142 AAGAACATGGATAATAAGAAGGG + Intergenic
1097442524 12:59628426-59628448 AAGAACTTAGAGAAGAAGATTGG - Intronic
1098146453 12:67502562-67502584 AAGAAAATGGAGATCCAGATGGG - Intergenic
1098515065 12:71365995-71366017 AAGGACATGGAGGAATTGATGGG + Intronic
1099603740 12:84775125-84775147 AAGAATATGGAGAAAGAGAGGGG - Intergenic
1100451500 12:94711242-94711264 AAAAAGATGGAGAAGTTGATGGG - Intergenic
1102021444 12:109686234-109686256 GAGGACATGGAGAACCAGAAAGG - Intergenic
1103131796 12:118475508-118475530 AGGAAAGTGGAGAACTAGGTAGG + Intergenic
1103951300 12:124552840-124552862 AAAAACATAGAAAACTAGCTGGG - Intronic
1106893575 13:34273174-34273196 AAGAACATTGGGAAGTAGAGTGG + Intergenic
1107104103 13:36625303-36625325 AAGCACATGTAGAAGTAGACAGG + Intergenic
1108290042 13:48949966-48949988 AAGAACACTGAGATCTAAATAGG + Intergenic
1108707762 13:53005632-53005654 TAGAACATGGAGCACTGGACGGG + Intergenic
1109179474 13:59196941-59196963 ATGAACTTGGAGAACTAAAGAGG + Intergenic
1109279004 13:60334263-60334285 AAAAACATAGACATCTAGATAGG - Intergenic
1109408233 13:61929021-61929043 AAGCACATTGATAACTAGCTAGG + Intergenic
1110228210 13:73141895-73141917 AACAATGTGGAGAACTAGACTGG - Intergenic
1112746678 13:102534654-102534676 AAGAAGTTGGAGAAGTACATGGG + Intergenic
1113016804 13:105837179-105837201 AAGAACGTGGAGTCCTAGAATGG + Intergenic
1115290513 14:31766925-31766947 AAGAGTAGGGAGAAGTAGATGGG + Intronic
1115527200 14:34293227-34293249 ACAAATATGAAGAACTAGATTGG + Intronic
1115900074 14:38136278-38136300 AGGAAAATGGAGAGCTAGACTGG - Intergenic
1115965668 14:38884760-38884782 AAGAGCATGGAGACCTCTATAGG - Intergenic
1116343953 14:43764750-43764772 AAGAGCATAGAGAACAAAATAGG + Intergenic
1116417937 14:44700685-44700707 ATGAAAATGTAGAACTAGAGGGG + Intergenic
1116494020 14:45538641-45538663 AAGAATATGGAGATATAGAAGGG - Intergenic
1124037127 15:26064531-26064553 AAGAAAATGAAAAACTAGCTGGG - Intergenic
1125823552 15:42655717-42655739 AAAAACAAAGAGAAATAGATGGG + Intronic
1125999870 15:44198557-44198579 AAGCATAAGGAGAACTAGAAAGG + Intergenic
1130379863 15:83362293-83362315 GAGACCATGGAGAACTATAAGGG + Intergenic
1130814722 15:87419315-87419337 AAGACAATGGAGATCTAGAAGGG - Intergenic
1133377586 16:5301094-5301116 TAGAACATGGAGAAAATGATGGG + Intergenic
1133637469 16:7682170-7682192 AAGAACATGAAAAACAAAATTGG - Intronic
1134639241 16:15816391-15816413 AAATACATGGAAAACAAGATTGG + Intronic
1136560715 16:31037715-31037737 AAGATCATGGAGGACCACATAGG + Intronic
1137445667 16:48530495-48530517 AAGAACAGGCAAAACTACATGGG - Intergenic
1138154129 16:54686770-54686792 AAGAACATGGACAGATAAATAGG - Intergenic
1139168940 16:64606864-64606886 AATAACATCTAGAACTAGAAAGG + Intergenic
1141024454 16:80531875-80531897 AAGAACATATACAACAAGATAGG - Intergenic
1141755215 16:85986493-85986515 AAGCAGATGGAGAACTGGAATGG + Intergenic
1143865013 17:9917223-9917245 GTGGACATGGAGATCTAGATGGG - Exonic
1145219520 17:21076747-21076769 AAGATGATGGAAAAATAGATGGG - Intergenic
1146572284 17:33963081-33963103 AAGAACATTGAGATCTAGAGAGG + Intronic
1146588541 17:34106010-34106032 AAGAAACTTGACAACTAGATAGG - Intronic
1150348107 17:64420314-64420336 AAGAATCAGGAGAAATAGATGGG + Intergenic
1151504258 17:74516168-74516190 AAGAACATGAAAGACTAGATTGG - Intergenic
1153264270 18:3253942-3253964 AGGAACATGGTGAAATTGATGGG - Exonic
1153266651 18:3277306-3277328 AGGAACATGGTGAAATTGATGGG - Exonic
1154085146 18:11297297-11297319 AAAAACATGGAGACCAAAATAGG + Intergenic
1154981044 18:21502634-21502656 AAAAACAAGGAGATGTAGATGGG - Intronic
1155716365 18:28949231-28949253 ATAAACATTAAGAACTAGATTGG + Intergenic
1157847291 18:51015773-51015795 AAGACCATAGAGAATTAGATTGG - Intronic
1158998662 18:62950534-62950556 AAGAACATGGGGAAATGGCTGGG + Intronic
1159119705 18:64154560-64154582 AAGTATATTTAGAACTAGATAGG - Intergenic
1160039274 18:75331234-75331256 AAGAAGATGAAGAAGTAGAAGGG - Intergenic
1160484995 18:79282758-79282780 AAGTACATAGGAAACTAGATAGG - Intronic
1160922305 19:1526721-1526743 AAGAACATGGAGGTGAAGATTGG + Exonic
1161968130 19:7560433-7560455 AAGAACATGGAGAGATTGATTGG + Intronic
1162188666 19:8927471-8927493 AAGAACATGGAGAAATGATTGGG + Intronic
1163736422 19:18984071-18984093 AAGAACGTGGAGAGCCAGAAAGG + Intergenic
1165324847 19:35108631-35108653 AAGAACATACAGAACAGGATGGG + Intergenic
1168440727 19:56364312-56364334 AAGAAAGTTGAGAACTAAATAGG + Intronic
1168519451 19:57036950-57036972 AAGAACGTGAAAAACTAGACTGG + Intergenic
925325968 2:3022268-3022290 AAGAGCATGGAGTACAGGATTGG + Intergenic
925360954 2:3280054-3280076 AAGAAAATGGTGAACCAGAATGG - Intronic
927793255 2:26027351-26027373 AAGAACACGGAGAGCAAGTTGGG + Intergenic
930332547 2:50004115-50004137 AAGAAGATGGAGATAGAGATAGG + Intronic
930423469 2:51182623-51182645 AAAAACAAGGATAAATAGATGGG + Intergenic
930487834 2:52030426-52030448 AAGAACATGTGGAGCTAGATAGG + Intergenic
931402013 2:61940171-61940193 GAGAAGCTGGAGTACTAGATGGG - Intronic
932951727 2:76301760-76301782 TAAAACATGGAAAACTTGATGGG - Intergenic
934097771 2:88623315-88623337 AAGAACATGGACAACGAGATTGG + Intronic
935548117 2:104422391-104422413 AAAAACATGGAGAAAAAGAAAGG - Intergenic
936446262 2:112597889-112597911 AAGAAAATGTAGAACTAGGCTGG + Intergenic
936622553 2:114115738-114115760 ACCAACATGGAAAAGTAGATTGG - Intergenic
936640777 2:114310669-114310691 AAGAATATAGAGAAAGAGATAGG - Intergenic
937732633 2:125252865-125252887 AAGAACATGAAAAACTAGACTGG - Intergenic
940958691 2:159757647-159757669 AAAAACATGTAGAAATAAATGGG + Intronic
941050493 2:160727408-160727430 AATAACATTGATAACTGGATAGG - Intergenic
941428476 2:165382018-165382040 AAGAAAATGGATAGCTATATTGG + Intronic
941617321 2:167735458-167735480 AAGCACAGGGAGAAATAGATTGG - Intergenic
944057414 2:195537598-195537620 GAGAAAATGGAGAACAAGAGAGG + Intergenic
945148494 2:206763741-206763763 TAGAGCAAGGAGAACTAGTTTGG - Intronic
945362851 2:208912481-208912503 AAAAACAAAGAGAAATAGATGGG + Intergenic
947885247 2:233564267-233564289 AGGAACATGGCAAACCAGATAGG + Intronic
947901837 2:233727645-233727667 AAGGACATAGAGCACTAGAAAGG - Intronic
1168751995 20:289215-289237 AAGAACATGGACAATTATGTGGG - Intronic
1169408237 20:5344110-5344132 TTGAACATGGAGCACTAGAGAGG - Intergenic
1169538054 20:6567874-6567896 AAGATCATGGAGAGCTAATTAGG - Intergenic
1170867530 20:20172728-20172750 ATGAACATCCAGCACTAGATTGG + Intronic
1171071385 20:22071667-22071689 AAGATCAAGGAAAACTAAATAGG - Intergenic
1172657879 20:36548085-36548107 AGGAACATGGTGAAGTTGATGGG - Exonic
1173673988 20:44817896-44817918 AAGAAAAAAGAGAACTAGGTAGG + Intergenic
1174785127 20:53425251-53425273 CAGAACATGGACAACAAGAAAGG - Intronic
1175955694 20:62608018-62608040 AAGGACAAGGCAAACTAGATGGG + Intergenic
1176128997 20:63488353-63488375 AAGAACGTGGAGAAGAAGAGCGG - Exonic
1176154755 20:63613192-63613214 AAGAACAGTGAGAAGTAGAGAGG - Intronic
1177312066 21:19411021-19411043 AAGAACAAGGAGTCCCAGATTGG - Intergenic
1178537005 21:33418652-33418674 AATTACATGGAGCACTTGATGGG + Intronic
1178989820 21:37343466-37343488 GAGAAAATGGAGACCTAGATGGG + Intergenic
1179080741 21:38168638-38168660 AAGAACATGGAGAACTTCCCAGG - Intronic
1180977107 22:19854541-19854563 TAGAAAGTGGAGAACGAGATCGG + Exonic
1181364037 22:22360333-22360355 AAGAACAAAGATAAATAGATGGG - Intergenic
1181366841 22:22383428-22383450 AAGAACAAAGATAAATAGATGGG - Intergenic
1181373203 22:22434573-22434595 AAGAACAAAGATAAATAGATGGG - Intergenic
1183016354 22:34991076-34991098 CAGAACATAGAGAACCATATGGG + Intergenic
1184361305 22:44020506-44020528 AAGCACAGGCAGAACTAGCTGGG - Intronic
952519649 3:34143830-34143852 AACCACATGGAGAACTTGAAGGG - Intergenic
952541098 3:34369236-34369258 AAGAAGATGGAGAAATAAATTGG - Intergenic
952680915 3:36090999-36091021 AAGAAAATAGAAAAATAGATAGG + Intergenic
953086170 3:39669866-39669888 AACAACATGGAGAAAAAGAATGG - Intergenic
953231082 3:41065577-41065599 GAGAACAAGGAAAACAAGATGGG - Intergenic
955558839 3:60166771-60166793 AAGAAAATGGAAATCTAGTTAGG - Intronic
955998205 3:64700080-64700102 AAGAAGATGAAGAGCTAGAGAGG - Intergenic
956289544 3:67647122-67647144 AAGCACAGGGAGAAATGGATGGG + Intronic
957138252 3:76317217-76317239 AAGTACATGGAAAAATAGACTGG + Intronic
958785316 3:98591774-98591796 AAGAACATTTAGAGCTGGATGGG + Intronic
958894261 3:99812734-99812756 ATGATGATGGAGAAGTAGATGGG - Intergenic
960110705 3:113841903-113841925 AAGAGTATGGAGAACAAGCTGGG - Intronic
961147032 3:124602709-124602731 AAGGACATAGAGACCTGGATAGG + Intronic
961235184 3:125360199-125360221 TAGAACATGGAGAAGCTGATAGG - Intronic
964394021 3:156226540-156226562 AAAAACAAAGAGAAATAGATGGG + Intronic
964436041 3:156654952-156654974 AAGTAGATGGGAAACTAGATGGG + Intergenic
965144322 3:164880260-164880282 AAAAACATGGTAAACTAGCTCGG + Intergenic
967974407 3:195024895-195024917 AAGAACATGGAAAACAAGGCCGG - Intergenic
972012437 4:34201405-34201427 AAGAACCTGGACATCTAGGTGGG - Intergenic
972384868 4:38555389-38555411 AAGAACAAAGATAAATAGATGGG - Intergenic
972685441 4:41348261-41348283 AAAAAAATGGAGAATTAGGTAGG - Intergenic
972941569 4:44201595-44201617 AATTACATGGAGAATTACATTGG + Intronic
975754181 4:77556740-77556762 AAGAAAATGGGAAACAAGATTGG + Intronic
977224310 4:94376409-94376431 AAGAGAATGGAGAACTACATTGG + Intergenic
977246092 4:94633437-94633459 AATAACTTGAAGAAGTAGATGGG - Intronic
977888530 4:102279859-102279881 AACCACATGGAGGACAAGATTGG + Intronic
978015757 4:103744246-103744268 AAGAACATCTACATCTAGATAGG + Intergenic
978272689 4:106909562-106909584 AAGAACATGGGGAAGTGGTTGGG + Intergenic
978781309 4:112557879-112557901 AAGAACATGTAGGGCTAGAGAGG - Intronic
979703918 4:123697884-123697906 AAGAAAATAGAGAATTTGATGGG - Intergenic
980206599 4:129727057-129727079 AAGAACTTGAATAATTAGATTGG + Intergenic
981138217 4:141237181-141237203 TAGAACATTGAGAACTTGGTAGG + Intergenic
981228191 4:142321439-142321461 AAAAACAGAGAGAAATAGATGGG - Intronic
981278448 4:142929317-142929339 AAGAACATTGAGAAGAAGAGAGG - Intergenic
981648990 4:147034603-147034625 AATAACAGGGAGAACTGGAAGGG - Intergenic
981874897 4:149530149-149530171 AAGAAGATAGAGAGCAAGATGGG - Intergenic
983693475 4:170500603-170500625 AAGAACATGGAGAAGAATGTGGG - Intergenic
984992228 4:185392218-185392240 AAGAACTTGGAGAACTTGAAAGG - Intronic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
986883761 5:12208519-12208541 CAGAACATGGAGCACTAAGTGGG - Intergenic
987020494 5:13865286-13865308 AAGAAAATGGAGAGCTGGCTGGG - Intronic
987806186 5:22771968-22771990 AAGAACATTGACAACTATAGAGG + Intronic
988415248 5:30938918-30938940 GAGAACATGGAGAATTAACTAGG - Intergenic
990113438 5:52357735-52357757 AACAACAGGGAAAATTAGATAGG - Intergenic
990216500 5:53538050-53538072 AAGAGCATGGAGAACATGATGGG - Intergenic
990716627 5:58644671-58644693 AAGAACCAGGAGAAATAGTTAGG - Intronic
991122368 5:63031364-63031386 AAGAACATGGAGGATCAAATGGG - Intergenic
991255668 5:64611363-64611385 AAGAACGTGCTGAACAAGATTGG - Exonic
992335592 5:75765457-75765479 AAAAACAAGGATAAATAGATAGG - Intergenic
994702063 5:103146548-103146570 AAGATCATGTAGAAGTAAATGGG + Exonic
995781340 5:115779053-115779075 AAAAAAATGCAGAAGTAGATAGG - Intergenic
996989003 5:129605281-129605303 TAGAACATGTAGAACTTGGTGGG - Intronic
997362964 5:133306720-133306742 AAGGACATGGAGAAATACATCGG - Intronic
998715064 5:144873907-144873929 AATAACAGGGAGATCTAGTTAGG + Intergenic
999411949 5:151358020-151358042 AAGGACAGAGAGAACTTGATTGG + Intergenic
999537168 5:152529791-152529813 CAGAACATGGAGAACTTTGTAGG + Intergenic
999654483 5:153798833-153798855 AAGAACAAGGAGAAATATAGGGG + Intronic
1002334595 5:178469222-178469244 AAGAACACGGAGACCCAGACAGG - Intronic
1004911403 6:20288543-20288565 AAGAAAATAGAGAAAGAGATTGG - Intergenic
1005787542 6:29261728-29261750 AATAAAATGTAGGACTAGATTGG - Intergenic
1005792775 6:29323273-29323295 AAAAACAAGGATAAATAGATAGG - Intergenic
1005804180 6:29458597-29458619 AAGAACATGTGGAAATTGATGGG - Intronic
1006287516 6:33107930-33107952 AAGAAAATGGAGAAGCAGAGAGG - Intergenic
1006323983 6:33339214-33339236 AGGAACATGGTGAAATCGATGGG - Intergenic
1006933799 6:37703621-37703643 AAGAGGATGGAGAACTAGGAAGG + Intergenic
1008012065 6:46478619-46478641 AAGACTTTGGAGCACTAGATCGG - Intronic
1009527910 6:64770358-64770380 AAGAACATGGAAAGCTATATAGG + Intronic
1009543670 6:64999173-64999195 GAGAACCTAGAGAACTAAATTGG + Intronic
1009970169 6:70616936-70616958 AAGAACATGGACTACTAGACTGG + Intergenic
1010274574 6:73954423-73954445 AAGAACAAAGATAAATAGATGGG - Intergenic
1011567998 6:88700336-88700358 AAAAACCTGGAGATCAAGATTGG - Intronic
1012924383 6:105252966-105252988 ATAAACCTGGAGAACAAGATGGG + Intergenic
1014126310 6:117780487-117780509 AAGAAAATGGAGAAAGACATTGG - Intergenic
1015363265 6:132366424-132366446 AAAAACAATGAGAACTAGACGGG + Intronic
1016510353 6:144835887-144835909 AAGAACGTGGAGAACTGGAGAGG + Exonic
1016895326 6:149045758-149045780 AAGAAAATGGAGAACTAGAAGGG - Intronic
1016962374 6:149686431-149686453 AAGAACATGGAGAGCTCTGTGGG - Intronic
1020426454 7:8071672-8071694 AAGAACATGGAGAGACAGTTGGG - Intronic
1021009608 7:15445306-15445328 AAGAACATTCAAAACTATATTGG + Intronic
1021113188 7:16719396-16719418 AAGAACATTAAGTACTAAATAGG + Intergenic
1023238395 7:38115333-38115355 AAGAACATGAAGAAGTATTTAGG - Intergenic
1023439483 7:40171245-40171267 AAGAGCAAGGAGAAAAAGATGGG + Intronic
1026015050 7:66666086-66666108 ATGACCATGGAGAACCACATAGG - Intronic
1026589831 7:71684997-71685019 GAGAACATGGAGATTCAGATAGG + Intronic
1028464352 7:91133556-91133578 AGTAACATGGAGAAATACATGGG + Intronic
1030345337 7:108427005-108427027 TGGAATATGGAGAAGTAGATTGG - Intronic
1031942456 7:127803304-127803326 AAGAACATGGAGAGCAGGAAAGG - Intronic
1034846226 7:154448099-154448121 AAAAACAAGGACAACCAGATAGG + Intronic
1036631239 8:10517480-10517502 CATAACATGGAGAACATGATAGG - Intergenic
1037050834 8:14371897-14371919 AAGAAGATGGAGATCAATATAGG + Intronic
1037570856 8:20156629-20156651 AAGAGCAAGGAGAAAAAGATGGG - Intronic
1038352623 8:26792022-26792044 AAGGACAAGGAGCACTAGAATGG + Intronic
1038511050 8:28135901-28135923 AAGAACAAAGAGAACAAGAAAGG - Intronic
1038909157 8:31942518-31942540 AAAAACAAAGAGAAATAGATGGG + Intronic
1041689211 8:60672825-60672847 AAGAATGTGGAAAACTAGACTGG - Intergenic
1042285875 8:67109694-67109716 AAGAACCTGGGGTACTAGTTCGG - Intronic
1042768971 8:72358036-72358058 CAGACCATGGAGAACTTGAAAGG - Intergenic
1043321539 8:78993195-78993217 AAGGATATGGAGAAATTGATTGG + Intergenic
1043362746 8:79494560-79494582 AAAAACAAGGATAAATAGATAGG - Intergenic
1043444389 8:80305033-80305055 TTAAACATGGAGAACTAGAGAGG - Intergenic
1045069418 8:98485781-98485803 ATGAGCCTGGAGAAGTAGATGGG + Intronic
1046361482 8:113163820-113163842 AAGTAGATGGAGAACTGCATTGG - Intronic
1046824648 8:118674075-118674097 AAGATCATGGAGGGCTATATAGG - Intergenic
1047053217 8:121136568-121136590 AAGAAGAAGGAGAAATAAATTGG + Intergenic
1047304778 8:123643830-123643852 ATGAACCTGGAGAGCCAGATGGG + Intergenic
1048978302 8:139687809-139687831 AATCACATGGAGAAGTGGATGGG - Intronic
1049201852 8:141344141-141344163 CAGAACATGGAAAATTAAATAGG + Intergenic
1051155090 9:14133994-14134016 AAGAAAATGGAGAAATTGAGAGG - Intronic
1051511620 9:17884955-17884977 AAGAAAATGGAAAACTTGTTTGG - Intergenic
1051934736 9:22433506-22433528 AAGAACATTCAAAACTTGATAGG - Intergenic
1054759754 9:68993625-68993647 AAGAAAATGGGGAATTAAATAGG + Intronic
1054893267 9:70276671-70276693 AAGAAGATGGATGAATAGATGGG + Intronic
1056514912 9:87341073-87341095 AAGAGCATGAATAACTAGACTGG + Intergenic
1058378286 9:104350287-104350309 AAGAAAATGGAGAAAGAGTTGGG + Intergenic
1058556404 9:106173312-106173334 AAGAAGAAGGAGAACAAGAAGGG - Intergenic
1058900639 9:109439316-109439338 AAGAAAATGGAATACGAGATCGG - Intronic
1059340346 9:113594434-113594456 AAGGACATGAAGAACAAGCTGGG + Exonic
1060611875 9:124973939-124973961 AAGAACATGGAGAACTAGATGGG - Intronic
1061107965 9:128546872-128546894 AAGCACCTGGAGCACTTGATGGG + Intergenic
1186149658 X:6660865-6660887 AAGAAACAGGAGAACTCGATAGG - Intergenic
1187044063 X:15628198-15628220 ACGAACATGGAGAACAGGAAGGG + Intronic
1187076384 X:15939346-15939368 AAGAGGATGGAGAATTACATGGG + Intergenic
1188028425 X:25235901-25235923 ATGTACATGGAGAAAAAGATTGG + Intergenic
1189116707 X:38350390-38350412 GTGAACAAAGAGAACTAGATAGG + Intronic
1189400112 X:40659951-40659973 ATGAAGAAGGAGAACTAGATGGG + Intronic
1189798481 X:44669987-44670009 GAGAAAATGGAGAACTATTTAGG - Intergenic
1190396618 X:49991560-49991582 AAGAACAAAGATAAATAGATGGG - Intronic
1191665786 X:63701048-63701070 AAGAACAAAGTGAAATAGATGGG - Intronic
1192680105 X:73243427-73243449 AAGGACATAGAGAAAGAGATAGG + Intergenic
1192814421 X:74576167-74576189 AAGAACCTGGACACCAAGATTGG + Intergenic
1193414320 X:81202956-81202978 AAGTATATTGAGAACTGGATAGG + Intronic
1195392879 X:104381414-104381436 AAGAACATTGTGAACTAGGAAGG - Intergenic
1197457142 X:126691115-126691137 AAGAACATGAAGAAGGAGAAGGG + Intergenic
1197489454 X:127100271-127100293 AAGAGCAAGGAAAACTAGGTTGG + Intergenic
1197642129 X:128978408-128978430 AAAAACAAAGATAACTAGATGGG + Intergenic
1198265215 X:135002590-135002612 AAGAAAGTGAAGAATTAGATAGG + Intergenic
1199941582 X:152632906-152632928 ATGAACTTGAAGATCTAGATTGG - Intergenic
1200341864 X:155406072-155406094 CAGAATATAGAGAAATAGATGGG + Intergenic