ID: 1060620443

View in Genome Browser
Species Human (GRCh38)
Location 9:125060835-125060857
Sequence GAAAATGGACTAATACAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060620437_1060620443 30 Left 1060620437 9:125060782-125060804 CCAATTAAACCTCTTTTTCTTCC 0: 761
1: 922
2: 686
3: 1081
4: 5268
Right 1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG No data
1060620438_1060620443 21 Left 1060620438 9:125060791-125060813 CCTCTTTTTCTTCCCAGTCTCAG 0: 407
1: 617
2: 837
3: 680
4: 969
Right 1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG No data
1060620441_1060620443 8 Left 1060620441 9:125060804-125060826 CCAGTCTCAGGTATGTCTTTATG 0: 41
1: 3075
2: 6532
3: 10938
4: 11626
Right 1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG No data
1060620440_1060620443 9 Left 1060620440 9:125060803-125060825 CCCAGTCTCAGGTATGTCTTTAT 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
Right 1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060620443 Original CRISPR GAAAATGGACTAATACAGCT AGG Intronic
No off target data available for this crispr