ID: 1060623866

View in Genome Browser
Species Human (GRCh38)
Location 9:125092637-125092659
Sequence ATGTCCTTGAATAACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060623866_1060623871 18 Left 1060623866 9:125092637-125092659 CCCTCACTGTTATTCAAGGACAT 0: 1
1: 0
2: 0
3: 15
4: 240
Right 1060623871 9:125092678-125092700 CTTCTTGCAGCATCACCAATGGG No data
1060623866_1060623872 30 Left 1060623866 9:125092637-125092659 CCCTCACTGTTATTCAAGGACAT 0: 1
1: 0
2: 0
3: 15
4: 240
Right 1060623872 9:125092690-125092712 TCACCAATGGGCCTCTGTGCTGG No data
1060623866_1060623870 17 Left 1060623866 9:125092637-125092659 CCCTCACTGTTATTCAAGGACAT 0: 1
1: 0
2: 0
3: 15
4: 240
Right 1060623870 9:125092677-125092699 TCTTCTTGCAGCATCACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060623866 Original CRISPR ATGTCCTTGAATAACAGTGA GGG (reversed) Intronic
900949060 1:5847417-5847439 AAGTCCTTGAGAAACAGTGCTGG + Intergenic
901155685 1:7136387-7136409 ATGCCCTTGAGTAAAAGAGAAGG - Intronic
902900666 1:19513555-19513577 ATGTTATTGAAGAACAGTGGAGG - Intergenic
904252154 1:29232762-29232784 ATGGCCTAGACTAAAAGTGAGGG - Intergenic
904279411 1:29408419-29408441 ATGTCCTTGGGTAACAGGGCAGG + Intergenic
905279203 1:36838034-36838056 ATGTCCATGATTAAATGTGATGG - Intronic
907017868 1:51034818-51034840 GTTTCTTTGAAAAACAGTGAGGG + Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907215861 1:52863207-52863229 GTGTCCTTGAATGACAGAGCAGG + Intronic
908310663 1:62879313-62879335 CTGTCCCTGAATAACTGAGATGG - Intergenic
908976725 1:69907685-69907707 GTGTCCTTGATGAACATTGATGG - Intronic
908978398 1:69925224-69925246 ATATCCTTGATGAACATTGATGG - Intronic
909036289 1:70597543-70597565 ATATCCTTGATGAACATTGATGG - Intergenic
909044177 1:70689293-70689315 AGGACCTTGGATAACACTGAAGG + Intergenic
909367399 1:74843883-74843905 ATGATCTTGTATTACAGTGAAGG + Intergenic
911193468 1:94970900-94970922 AAGGCTTTGAATAACAGTGTTGG - Intergenic
911929624 1:103885367-103885389 ATATCCTTGATGAACATTGATGG - Intergenic
912446562 1:109740779-109740801 AGGTCCTTGACTGACAGAGAGGG - Intronic
913251067 1:116912081-116912103 ATGCCCTTGAGTAATAATGAAGG + Intronic
913454065 1:119013052-119013074 ATGTCCTTGAGTAAGTATGAAGG - Intergenic
913930971 1:124964263-124964285 ATATCCTTGATGAACATTGATGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919015436 1:192027498-192027520 ATATCCTTGACAAACATTGATGG - Intergenic
919429840 1:197479012-197479034 ATGTCCTTGAGTAATTGAGATGG - Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
923321843 1:232842064-232842086 ACGACCTTGAATATCTGTGAAGG - Intergenic
923345882 1:233052337-233052359 ATGTCCTTTTGTCACAGTGAGGG + Intronic
923592743 1:235334027-235334049 ATTTCCTAGAATAACACTCATGG - Intronic
923800163 1:237201287-237201309 AAGACCTTGAATAATAGTGAGGG - Intronic
923893415 1:238240799-238240821 ATGTCCTTTGTTAAAAGTGATGG + Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1065990232 10:31002219-31002241 ATTTCTTTGATTACCAGTGACGG + Intronic
1068212914 10:53944902-53944924 ATGTCCTTGCATATCCATGATGG + Intronic
1071123655 10:82309748-82309770 AAGTCCTGGAATCACAGTGTCGG + Intronic
1071213690 10:83373921-83373943 ATGTCCTTGTTTAACAAGGATGG - Intergenic
1071933428 10:90499479-90499501 ATGACCTGGAGTAACAGTGTCGG + Intergenic
1072752021 10:97987904-97987926 ATGTCCCTGAAACACAGGGATGG + Intronic
1072778271 10:98223256-98223278 ATATCCTTGATGAACATTGATGG + Intronic
1073752387 10:106543606-106543628 CTGACCTTTAATATCAGTGATGG - Intergenic
1074242420 10:111652238-111652260 AGGTACTTGTATTACAGTGATGG + Intergenic
1075346502 10:121685866-121685888 ATGGTCTTGAATCAGAGTGAAGG + Intergenic
1075364255 10:121869869-121869891 ATATTCTTCAATAACAGTAATGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079197767 11:18345295-18345317 ATGTCATTGAATAAAACAGAGGG - Intronic
1080236706 11:30077965-30077987 ATGTCCATGAATAACCATGAAGG - Intergenic
1080573200 11:33575846-33575868 AAGGCCTTGAATGACAGGGAAGG + Intronic
1081067339 11:38561737-38561759 ATGTTCTTTAATAATAGTAAAGG - Intergenic
1081115690 11:39196567-39196589 ATGTTCTTAAAGAACTGTGATGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1086139807 11:83484215-83484237 TTGTCATTGAATGACTGTGAAGG + Exonic
1086785798 11:90968699-90968721 ATATCCTTGATGAACATTGATGG - Intergenic
1087117396 11:94540482-94540504 TTATTCTTGAATAACAGTGCGGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088037084 11:105330152-105330174 ATGTCCTGTAATAAAAGTAATGG + Intergenic
1088254834 11:107893658-107893680 ATTTACTTGAATAATATTGAGGG - Intronic
1089140877 11:116282944-116282966 CTGTCCTGGAAGAAAAGTGAAGG + Intergenic
1090151724 11:124391829-124391851 ATATCCTTGATGAACATTGATGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1090930438 11:131293180-131293202 ATGTCCTTGACTGAGAGTAAAGG - Intergenic
1091399402 12:173207-173229 ATGTCTTGGAAGGACAGTGAGGG + Intronic
1092766851 12:11860913-11860935 GTGTTCTTGGATAACAGTGAGGG - Intronic
1094636692 12:32233359-32233381 ATGACCTTGAAAAACAGTAAAGG - Intronic
1094800502 12:34028120-34028142 ATGTCCTTTAGTAACTGTCATGG - Exonic
1095113298 12:38322406-38322428 ATGTCCTTTAGTAACTGTCATGG - Exonic
1095642225 12:44498932-44498954 ATTTCTTTAAATAACTGTGAAGG - Intergenic
1096946913 12:55416819-55416841 ATATCCTTGATTAACATAGATGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098647851 12:72927434-72927456 ATGTCCTGGAGTAACTGAGAAGG + Intergenic
1100468585 12:94871394-94871416 GTGTCCTTGAATGAAAGAGAAGG - Intergenic
1101001869 12:100364864-100364886 ATGGCCCTGAAGGACAGTGAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101506430 12:105350790-105350812 CTGTCCTTGAAAAGCAATGATGG - Intronic
1102064694 12:109964505-109964527 AGGTCCTTGAATCAGAGAGATGG + Intronic
1103485029 12:121276922-121276944 ATGTCCCAGGAAAACAGTGAGGG + Intronic
1103923652 12:124412176-124412198 AAGTCCTTGATTAAAAGTGCTGG - Intronic
1104093048 12:125531935-125531957 ATGTGCTGGAATAACAGTGTGGG - Intronic
1104772279 12:131370971-131370993 AAGCCCTTGAAATACAGTGACGG + Intergenic
1105110470 13:16607284-16607306 ATGTACTCAAATAACAGAGAAGG + Intergenic
1105125199 13:16848284-16848306 ATGTACTCAAATAACAGAGAAGG + Intergenic
1106980735 13:35276435-35276457 ATGTCATTGAATAACAGGTTTGG + Intronic
1108582635 13:51839887-51839909 ATGTCCTAGAAGGACAGTGATGG - Intergenic
1109085389 13:57965083-57965105 ATTTCCTGGAACAACAGTAATGG + Intergenic
1110251349 13:73384257-73384279 ATATCCTTGGGTAACAGGGATGG + Intergenic
1110251938 13:73390125-73390147 ATATACTTGCATTACAGTGAAGG + Intergenic
1111248189 13:85569458-85569480 ATATCCTTGATGAACATTGATGG - Intergenic
1111322396 13:86648031-86648053 ATATCCTTGATGAACATTGATGG - Intergenic
1111682633 13:91462460-91462482 ATGTCACTGAATTACTGTGAAGG + Intronic
1111761417 13:92470750-92470772 ATGTCCTTGAGTCATTGTGAAGG - Intronic
1111786857 13:92798525-92798547 ATTTGCTTGAATTACAGTGTAGG - Intronic
1112297305 13:98199198-98199220 AGGTTCTTAAATAGCAGTGATGG - Intronic
1112769004 13:102774989-102775011 ATGTTCTTAAATTATAGTGATGG - Intergenic
1115125594 14:29989227-29989249 ATGTCCTTGAATCAGAGGGATGG - Intronic
1117162615 14:53004105-53004127 ATATGGTTGAATAAAAGTGAAGG - Intergenic
1120352253 14:83377367-83377389 ATGTTCATGGAGAACAGTGAGGG - Intergenic
1121520444 14:94582623-94582645 ATGTCTCTGAATTACAGAGAAGG + Intronic
1121708791 14:96021365-96021387 ATGACCTTGATTTCCAGTGATGG - Intergenic
1125385203 15:39129758-39129780 AAGCCTTTGAATAACAGTGCTGG - Intergenic
1127266649 15:57367599-57367621 ATGTCCTTGAATTTCATGGAAGG + Intergenic
1130100978 15:80893944-80893966 ATGTCTTTGAATGATAGTCATGG + Intronic
1137557611 16:49482654-49482676 TTGTCCTTGTTTGACAGTGAGGG - Intergenic
1140452804 16:75084720-75084742 ATGTATTAGAAGAACAGTGAGGG - Intronic
1146889374 17:36496127-36496149 ATGCACATGAACAACAGTGACGG - Exonic
1153645191 18:7189587-7189609 ATGTCCTTAAATGATAGTAATGG + Intergenic
1154346378 18:13546624-13546646 ATGTCACTGAATAACACTGGTGG + Intronic
1155748693 18:29392304-29392326 CTGTCCCTTAATAACAGTAATGG - Intergenic
1156062685 18:33099533-33099555 ATGCCCATGAATAAAAGTGGGGG - Intronic
1157099939 18:44720269-44720291 ATGTCCTGGAATATCAGAGTTGG - Intronic
1158658577 18:59363570-59363592 ATGTTCTTGATTAACTGTGCAGG - Intergenic
1159540965 18:69775352-69775374 ATTAACTTTAATAACAGTGATGG + Intronic
1164484512 19:28643368-28643390 AAGCCCTGGAATCACAGTGAAGG + Intergenic
925218568 2:2118908-2118930 ATCTCCTAGGAGAACAGTGACGG + Intronic
926933549 2:18064154-18064176 ATGCCCTTGATTAATAGTGATGG + Intronic
928765807 2:34644250-34644272 ATGTCATGGAATCACAGTGTGGG + Intergenic
929092449 2:38232828-38232850 ATGTCCTTGATAAATATTGATGG - Intergenic
929199853 2:39223519-39223541 ATTTCCTTGATTAATAGGGAAGG + Intronic
929282501 2:40096439-40096461 ATCTCCTTGAATAAGAGAAATGG + Intergenic
930245898 2:48983067-48983089 ATGGCCTTGAAGAATAGTCAGGG + Intronic
931499382 2:62847898-62847920 ATCTCCCTGATTAAAAGTGATGG - Intronic
931905581 2:66839221-66839243 ATATCCATGAATAAAAGAGATGG - Intergenic
932460659 2:71879867-71879889 ATGTTCTTGAAAAACAGAGAAGG + Intergenic
933127516 2:78628162-78628184 CTGCCCTTGAAAAACAATGAAGG + Intergenic
933650830 2:84848943-84848965 ATTTCCTTCAGAAACAGTGAAGG - Intronic
936762945 2:115808341-115808363 ATGTTCTTGAATGAGAGTGCAGG + Intronic
936868423 2:117105013-117105035 ATATCCTTGATGAACATTGATGG - Intergenic
938744598 2:134265318-134265340 ATCTCCTTGAATTCCAGAGATGG + Intronic
939964209 2:148594719-148594741 TTGTCCTCTAATCACAGTGAAGG - Intergenic
940273806 2:151918557-151918579 ATGTGCTTGTGTAACAGTGGAGG - Intronic
940993150 2:160118231-160118253 ATATCCTTGACGAACATTGATGG + Intronic
941653552 2:168119266-168119288 ATGTACAATAATAACAGTGAAGG - Intronic
942508170 2:176665849-176665871 ATGTACTAGAGAAACAGTGAAGG + Intergenic
942554569 2:177158137-177158159 ATGTCTTTGAATAGCATTTATGG - Intergenic
944000973 2:194837023-194837045 ATATCCTTGATGAACATTGACGG - Intergenic
945058029 2:205885027-205885049 ATGTCCTCCACTACCAGTGAGGG - Intergenic
945317443 2:208385322-208385344 ATTTCTTTGAATATTAGTGAAGG - Intronic
1171302672 20:24077549-24077571 ATGTCCTTATATGACAGGGAAGG + Intergenic
1180046035 21:45305956-45305978 ATGTGCATGAATGACAGAGAAGG - Intergenic
1181779213 22:25180779-25180801 ATTTCCTTTAATAACAGAAATGG - Intronic
1181821508 22:25479292-25479314 ACATCCTTGGATCACAGTGATGG + Intergenic
1183423617 22:37725950-37725972 AGGTCCTGGAATAAGAGGGAAGG - Exonic
1185132970 22:49050890-49050912 ATTTTCTTGATTAACAGTGTGGG + Intergenic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
958539958 3:95458488-95458510 ATCTCCTTGAATGATGGTGAGGG + Intergenic
958898456 3:99857253-99857275 ATGTTCTTGGAGAACACTGATGG - Intronic
959181867 3:102991140-102991162 ATGACATTGCATAAGAGTGATGG + Intergenic
959898596 3:111633864-111633886 TTGTCCTTGAACAACAGTATAGG - Intronic
963398559 3:144766181-144766203 ATGTCCTTTAGAAAAAGTGAGGG - Intergenic
964002151 3:151787950-151787972 ATGGCCTTAAATGACAGAGAAGG + Intergenic
964189926 3:153989751-153989773 ATATCCTTGAAGAACATAGATGG + Intergenic
965459359 3:168942823-168942845 AAGGCCTTAAATAACAGTAAAGG + Intergenic
965738203 3:171844861-171844883 ATGTCGTTGAGTTACAATGAAGG + Intronic
966342351 3:178939284-178939306 ATATCCTTGATGAACATTGATGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966967214 3:185005831-185005853 ATGTCATTGGCGAACAGTGATGG + Intronic
969215372 4:5717823-5717845 ATGTCCTAGAGTAACAGTGGAGG - Intronic
973022323 4:45219350-45219372 ATGTCTTTGAATCTCAGTGGGGG - Intergenic
974673630 4:65062829-65062851 AAGTCCTTGCATAACAGTATCGG + Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
978118463 4:105050060-105050082 CTGTCCTAGAATACCAGTGGGGG - Intergenic
978994820 4:115138036-115138058 ACGTCCTTGAGTAAGAGAGAAGG + Intergenic
979301310 4:119090803-119090825 ATATCCTTGATGAACATTGATGG - Intergenic
979722534 4:123918559-123918581 AGGCCATTTAATAACAGTGAGGG + Intergenic
980234154 4:130082090-130082112 ATGTTCATGAATATAAGTGATGG + Intergenic
980615460 4:135216778-135216800 ATGTCCATGACTATTAGTGATGG - Intergenic
980977634 4:139626058-139626080 ATTTCCTTGAAGATTAGTGATGG - Intergenic
982169118 4:152644094-152644116 ATGTCCTTGAAATACAGCTAGGG + Intronic
982311237 4:153987478-153987500 ATGTCCATACATAACAATGAGGG + Intergenic
986401468 5:7385810-7385832 AGGTACTTGAATCACAGTGGCGG - Intergenic
987557299 5:19470347-19470369 ATGTCTGTAAATAACAATGAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989654390 5:43730498-43730520 ATGTCCCTGAATAAAAGTAAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993078477 5:83266554-83266576 AAGTCCTTGAATAATACTAATGG - Intronic
994593266 5:101799254-101799276 ATGTCCATGCTTAACTGTGAAGG + Intergenic
994846821 5:105000504-105000526 ATGGCATTGAATAACATTGAGGG + Intergenic
995384898 5:111577938-111577960 ATATCCTTGATGAACATTGATGG - Intergenic
995896983 5:117025902-117025924 ATGTGTTTGAAAATCAGTGAGGG + Intergenic
996756069 5:126936406-126936428 ATATCCTAGACTACCAGTGAGGG + Intronic
998919287 5:147050066-147050088 ATGTGCTTGAGTAAGAGAGAGGG + Intronic
1000737276 5:164920310-164920332 ATATTTTTGAATAATAGTGAGGG - Intergenic
1001359507 5:171066916-171066938 ATGGCTTTGAATTACAGTGTAGG - Intronic
1002372730 5:178767947-178767969 ATTTCCTTGAATGAAAGTGGGGG + Intergenic
1202774847 5_GL000208v1_random:59870-59892 ATATCCTTGAAGAACATTGATGG - Intergenic
1005835514 6:29705793-29705815 ATATGCTTGAATAACAGGAAAGG - Intergenic
1006555133 6:34859381-34859403 ATCCCCTTGAAGAACATTGAGGG + Exonic
1008000625 6:46356271-46356293 TTGTCCATGAATATCAGAGAAGG - Intronic
1008721290 6:54356814-54356836 ATGTCCTTGAATAGCTAAGAGGG - Intronic
1012268320 6:97174591-97174613 TTGTCCTAGGATAACAGAGAGGG + Intronic
1012693197 6:102342785-102342807 ATATCCTTTAAAAAAAGTGAAGG - Intergenic
1014393228 6:120891432-120891454 ATGTCCTTGATGAACATCGATGG - Intergenic
1014603482 6:123444944-123444966 ATATCCTTGATGAACATTGATGG - Intronic
1015060287 6:128956161-128956183 ATGCCCTTGAGTAAAATTGATGG - Intronic
1015658065 6:135542062-135542084 ATATCCTTGATGAACATTGATGG + Intergenic
1016002130 6:139052425-139052447 CTATCCTTTAATAAAAGTGATGG - Intergenic
1016099424 6:140079456-140079478 ATGTGCCTGAATAACTCTGAAGG + Intergenic
1017298139 6:152823310-152823332 ATGGCCTTCATTAACAGAGAAGG + Intergenic
1018233009 6:161693967-161693989 ATGTCCTTGTACTTCAGTGAAGG + Intronic
1019900967 7:4020351-4020373 AGGTCCTTGAATAGCACAGAGGG - Intronic
1020698622 7:11448569-11448591 TTGACCTTAAATTACAGTGAGGG + Intronic
1021195772 7:17672872-17672894 ATGTCTGTGAATGACGGTGAAGG - Intergenic
1021289267 7:18823095-18823117 ATGTCCTTGAATAGGTGAGAGGG + Intronic
1021520306 7:21533203-21533225 ATATCCTTGATGAACATTGATGG - Intergenic
1021807215 7:24369242-24369264 ATGTGCTTGAATAGAAGAGAGGG - Intergenic
1021961675 7:25879224-25879246 ATGTTCTTGAGGCACAGTGAGGG + Intergenic
1022789030 7:33668500-33668522 ATGTCCATGATTTACAGTGAGGG + Intergenic
1022836698 7:34123712-34123734 ATGTGTTTGATTAACAGAGAAGG - Intronic
1022899124 7:34784608-34784630 ATATCCTTGATGAACATTGATGG - Intronic
1024670387 7:51588768-51588790 AGACCGTTGAATAACAGTGAAGG + Intergenic
1025226892 7:57173334-57173356 GTGTTCTTGAAGTACAGTGATGG - Intergenic
1025229959 7:57196615-57196637 GTGTTCTTGAAGTACAGTGATGG - Intergenic
1027646516 7:80808070-80808092 AGGTCCTTGAAAAACAAAGAAGG + Intronic
1027690609 7:81340215-81340237 ATGCCTTTGAACAACACTGATGG - Intergenic
1028337594 7:89676588-89676610 ATATCCCTGATGAACAGTGATGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030046152 7:105498636-105498658 ATGACCTTGAATAAGAAGGAAGG - Intronic
1030458104 7:109798687-109798709 ATATCCTTGATGAACATTGATGG + Intergenic
1031000775 7:116412439-116412461 ATATCCTTGATGAACATTGATGG + Intronic
1032343584 7:131098913-131098935 ATGACCTTGGAGAACAGTGGTGG - Intergenic
1036798487 8:11772548-11772570 ATGTCCTGGAAGCACAGAGATGG - Intronic
1036930058 8:12947504-12947526 ACGTCCTTGAATAAAATAGATGG + Intronic
1039833858 8:41239777-41239799 ATGTCTTTGAAGAGCAGGGAGGG - Intergenic
1040639075 8:49310692-49310714 CTTCCCTTGAATAAGAGTGAAGG - Intergenic
1044551311 8:93515555-93515577 AGGTCCTGGAAGTACAGTGATGG - Intergenic
1045389096 8:101697512-101697534 ATATCCTTGAAGAACATCGATGG + Intronic
1046337438 8:112808447-112808469 AAGTCCTTGAAGAAAAGTGGGGG - Intronic
1046442084 8:114270323-114270345 ATGTCCTTGACTAAAAGAGCAGG + Intergenic
1048888537 8:138928364-138928386 TTTTTCTTGAATAACAGGGACGG - Intergenic
1050536260 9:6633526-6633548 ATGTCATTGATTAACAGAGGGGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052090754 9:24323948-24323970 ATATTTTTGAATAACAGAGAGGG + Intergenic
1052333039 9:27290369-27290391 ATGTCCATAAATGACTGTGAAGG + Intronic
1052650714 9:31297647-31297669 ATATCCTTGATGAACATTGATGG + Intergenic
1053741644 9:41146017-41146039 TTTGCCTTGAAGAACAGTGAGGG + Intronic
1054686700 9:68285283-68285305 TTTGCCTTGAAGAACAGTGAGGG - Intronic
1054915957 9:70495455-70495477 ATGTCTTTGGCTAAGAGTGAGGG + Intergenic
1055966607 9:81871254-81871276 ATGTCCTTGAAAATCAAAGAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1059879099 9:118669895-118669917 ATGTCATTGAATTAAACTGAAGG + Intergenic
1060623866 9:125092637-125092659 ATGTCCTTGAATAACAGTGAGGG - Intronic
1188796866 X:34477933-34477955 ATATCCTTGATGAACATTGATGG - Intergenic
1188800435 X:34523495-34523517 ATGTCCTTAAACAACATTGCCGG + Intergenic
1189678614 X:43490396-43490418 ATATCCTTGATGAACATTGATGG + Intergenic
1191068289 X:56373832-56373854 ATATCCTTGATGAACATTGATGG + Intergenic
1191799362 X:65060243-65060265 ATTGTGTTGAATAACAGTGATGG + Intergenic
1194261175 X:91698229-91698251 GTGTCCTTGAAAGAGAGTGAGGG - Intergenic
1194819340 X:98486953-98486975 ATGCCCTTGAGTAACAGAGATGG + Intergenic
1195267939 X:103201672-103201694 ATGTCCATGAATAAGAGTTGTGG + Intergenic
1195951616 X:110280870-110280892 ATTTCCTTGATAAACTGTGAGGG + Intronic
1196915603 X:120531762-120531784 ATTTATTTGATTAACAGTGAAGG - Intronic
1197957963 X:131973431-131973453 ATGTCCTTGAATAGGGGAGAGGG + Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199144772 X:144351573-144351595 ATGACCTTGAATAACTGTACAGG - Intergenic
1200579825 Y:4937030-4937052 GTGTCCTTGAAAGAGAGTGAGGG - Intergenic
1200745000 Y:6896523-6896545 ATGTCTTTGTCTAACACTGAAGG - Intergenic
1201698616 Y:16855127-16855149 ATATCCTTGATGAACATTGATGG - Intergenic