ID: 1060628032

View in Genome Browser
Species Human (GRCh38)
Location 9:125131039-125131061
Sequence CCTCCCAAATACCTGGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060628024_1060628032 6 Left 1060628024 9:125131010-125131032 CCTGGGCTCAAGTGATGCTCCTA 0: 9
1: 1330
2: 21811
3: 97459
4: 208840
Right 1060628032 9:125131039-125131061 CCTCCCAAATACCTGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060628032 Original CRISPR CCTCCCAAATACCTGGGACT GGG Intronic
No off target data available for this crispr