ID: 1060629455

View in Genome Browser
Species Human (GRCh38)
Location 9:125143140-125143162
Sequence GAGGGGTGAGGCTGGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 3, 2: 7, 3: 86, 4: 715}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060629455_1060629469 19 Left 1060629455 9:125143140-125143162 CCGCGCCGCCAGCCTCACCCCTC 0: 1
1: 3
2: 7
3: 86
4: 715
Right 1060629469 9:125143182-125143204 GCCCCTCTCACCTGGCCTCGAGG 0: 1
1: 0
2: 1
3: 22
4: 276
1060629455_1060629468 11 Left 1060629455 9:125143140-125143162 CCGCGCCGCCAGCCTCACCCCTC 0: 1
1: 3
2: 7
3: 86
4: 715
Right 1060629468 9:125143174-125143196 CCTCACACGCCCCTCTCACCTGG 0: 1
1: 0
2: 1
3: 23
4: 219
1060629455_1060629473 22 Left 1060629455 9:125143140-125143162 CCGCGCCGCCAGCCTCACCCCTC 0: 1
1: 3
2: 7
3: 86
4: 715
Right 1060629473 9:125143185-125143207 CCTCTCACCTGGCCTCGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060629455 Original CRISPR GAGGGGTGAGGCTGGCGGCG CGG (reversed) Intronic
900032160 1:379994-380016 GAGGGGTGAGGCAGGCCATGGGG + Intergenic
900052710 1:608180-608202 GAGGGGTGAGGCAGGCCATGGGG + Intergenic
900141527 1:1141144-1141166 CAGGGATGGGGCTGGGGGCGGGG - Intergenic
900154565 1:1198793-1198815 GGGGGGTGGGCCTGGGGGCGGGG - Intergenic
900174129 1:1284323-1284345 GGGGGGTGGGGCTGGCGGGGGGG + Intronic
900244228 1:1630202-1630224 GGGGGGCGAGGCTGGGGGCGGGG - Intronic
900347178 1:2215359-2215381 GAGGGGTGAGGATGGGGGCAAGG + Intergenic
900394272 1:2446733-2446755 GAGGGGTTGGGCTGGCAGAGGGG + Intronic
900827941 1:4941532-4941554 CAGGGGTGGGGCGGGCTGCGGGG - Intergenic
900973609 1:6004929-6004951 GAGGGGTGAGGGTGGAGTGGGGG + Intronic
900973688 1:6005207-6005229 GAGGGGTGAGGGTGGAGTAGGGG + Intronic
900973754 1:6005445-6005467 GAGGGGTGAGGGTGGAGGCGGGG + Intronic
900973884 1:6005923-6005945 GAGGGGTGAGGGTGGAGTGGGGG - Intronic
900973915 1:6006041-6006063 GAGGGGTGAGGGTGGAGTGGGGG - Intronic
900973937 1:6006120-6006142 GAGGGGTGAGGGTGGAGTGGGGG - Intronic
900973950 1:6006160-6006182 GAGGGGTGAGGGTGGAGTGGGGG - Intronic
900973981 1:6006278-6006300 GAGGGGTGAGGGTGGAGTGGGGG - Intronic
900974018 1:6006397-6006419 GAGGGGTGAGGGTGGAGTGGGGG - Intronic
900974084 1:6006619-6006641 GAGGGGTGAGGGTGGAGTGGGGG - Intronic
900974118 1:6006738-6006760 GAGGGGTGAGGGTGGAGTAGGGG - Intronic
901061919 1:6475538-6475560 GAGGGCAGAGGCTGGAGGTGTGG + Intronic
901318425 1:8324335-8324357 GCGGGGTGCTGCTGGCTGCGGGG - Exonic
902214293 1:14924588-14924610 GCGGGGCGGGGCGGGCGGCGCGG + Intronic
902467377 1:16626481-16626503 GCAGGGTGAGGCTGGCCGCATGG - Intergenic
902507204 1:16946255-16946277 GCAGGCTGAGGCTGGCCGCGTGG + Exonic
902943890 1:19820047-19820069 GAGGGGTGGGGGTGGGGGTGGGG - Intergenic
903211039 1:21818866-21818888 GAGGGGTGGGGCGGGGGGCGGGG - Intronic
903555077 1:24187286-24187308 GAGGCGGGAGGCGGGAGGCGGGG - Intronic
903597172 1:24503322-24503344 GAAGGGTGCGGCGGGAGGCGAGG - Intronic
904053516 1:27655518-27655540 CAGGGGTGAGGGTAGCGGCAGGG + Intergenic
904256933 1:29260086-29260108 GAGGGGCGGGGCCGGCGACGGGG + Intronic
904473708 1:30751263-30751285 GAGGGGTGAGGAGGCCGGTGGGG - Intronic
904503757 1:30934055-30934077 GAGGGATGAGGCTGGTGTGGCGG - Intronic
904836220 1:33338834-33338856 GATGGGAGAGGCTGGGGGAGGGG + Intronic
905017969 1:34790717-34790739 GAGGGGTAAGGCTGGAGAAGTGG + Intronic
905146886 1:35893857-35893879 GAGGGATGAGGCTGGGAGTGTGG - Intronic
905414490 1:37794758-37794780 GAAGGGTGAGGCTGGGGGGCAGG - Intronic
906114739 1:43349087-43349109 GAGGGGCGAGGCGCGGGGCGCGG + Intronic
906149292 1:43578229-43578251 AATGGGTGGGGCTGGCGGGGAGG + Intronic
906554656 1:46699297-46699319 GAAGGGTGAGGGTGGCATCGGGG + Intronic
907270168 1:53286484-53286506 GAGGGGTGAGGGTGGGGGAGGGG - Intronic
907311245 1:53540359-53540381 GAGGGTTGAGGCTGGAGGCCTGG - Intronic
907342670 1:53748009-53748031 GAGGGGCCAGGCTGGAGGCAGGG - Intergenic
907490553 1:54806324-54806346 CAGGGCTGAGCCTGGCGGGGAGG + Intronic
908401956 1:63779809-63779831 GGGGGGTGTGGCTGGGGGCAGGG - Intronic
908464609 1:64379948-64379970 GATGAGTGAGGCTGGCAGAGCGG + Intergenic
909093513 1:71257333-71257355 GAAGGGTGAGGCTGGAGGACTGG - Intergenic
910288813 1:85580881-85580903 GCGGGGTCGGGGTGGCGGCGCGG - Exonic
911150382 1:94592502-94592524 GAGATGTGGGGCTGGGGGCGGGG - Intergenic
911220524 1:95240712-95240734 GTGGGGAGAGGCAGGCGGCGAGG + Intronic
911413443 1:97540332-97540354 GGGGGGTGGGGGTGGCGGCGGGG + Intronic
912158224 1:106948677-106948699 GAGGGAAGAGGCTGGAGGCAGGG + Intergenic
915248577 1:154572655-154572677 GAGGGGTGGCGTTGGTGGCGGGG + Intronic
915326225 1:155082446-155082468 GAGGGGGCAGGCGGGCGGAGCGG - Intronic
915455359 1:156036946-156036968 GAGGGGAGAGGCAGGAGGCATGG + Exonic
915908924 1:159900211-159900233 GAGGGGCGGGGCCGGGGGCGGGG - Intergenic
916205846 1:162315537-162315559 GAGAGGTGAGGATGACTGCGAGG + Intronic
916240226 1:162632105-162632127 GAGGTGTGGGGTAGGCGGCGGGG + Intronic
917306799 1:173634829-173634851 GAGGGGTGAGGAAGGTGGCATGG - Intronic
918586390 1:186193330-186193352 GAGGGGAGAGGATGGGGGAGGGG + Intergenic
919830769 1:201538989-201539011 GAGGGGAGTGCCTGGCGGCCGGG - Intergenic
919923015 1:202177460-202177482 GAGGACTGGGGCTGGCGGCCTGG + Intergenic
920116657 1:203626552-203626574 GAGGGGTGAGGGTGGAGGTGGGG - Exonic
920177772 1:204113816-204113838 GAGGAGTGAGGCAGGCAGTGGGG + Intronic
920213953 1:204348994-204349016 GATGGGTGGGGCTAGCTGCGTGG - Intronic
920226056 1:204440157-204440179 TAGGGGTGAGGGTGGAGGAGGGG - Intronic
920237309 1:204516615-204516637 GAGAGGTGGGTCGGGCGGCGTGG + Intronic
920401704 1:205680347-205680369 CAGGGGTGAGGGTCCCGGCGCGG - Intronic
920522052 1:206635346-206635368 GAGGCGGGAGGTTGGAGGCGAGG - Intergenic
921186213 1:212671786-212671808 CAGGGATGAGGCTGGAGGAGCGG - Intergenic
921996024 1:221419269-221419291 GAGGGGTGAGGTTGGCATCTGGG - Intergenic
922024968 1:221741630-221741652 GAGGAGTGAAGCGGGGGGCGGGG - Intronic
922726197 1:227924111-227924133 GTGGGGTGGGGCTGGCGGGGTGG - Intronic
922784427 1:228276060-228276082 GAGGAGTGAGGAGGGAGGCGGGG + Intronic
924383521 1:243483579-243483601 GAGGGGCTGGGCTGGCGGGGAGG - Intronic
924415183 1:243850332-243850354 GAGGAGAGAGGGCGGCGGCGGGG + Intronic
924554211 1:245104621-245104643 CAGGGGTGAGGATGGAGGTGAGG - Intronic
1062824680 10:558933-558955 GAGGGGTTGGGCTGTCGGTGGGG - Intronic
1063198250 10:3763103-3763125 GATGGGTGTGGCAGGCAGCGTGG - Intergenic
1063971180 10:11382293-11382315 GAGGGGTGAGAATGGGGGCTTGG - Intergenic
1064035037 10:11908090-11908112 GAGCGGTGAGGCAGGCGGCAGGG + Intergenic
1065101434 10:22335931-22335953 GAGGGGTGAGGCGGGAGACCGGG - Intergenic
1065112024 10:22449601-22449623 GAGGGGTGACTCTGGCAGCCAGG - Intronic
1065214690 10:23438858-23438880 GCGGGGCGAGGCCGGGGGCGCGG - Intergenic
1065705571 10:28468995-28469017 GAGGGGTGTGGCTGGGGAGGCGG - Intergenic
1066464157 10:35639300-35639322 GAGGGGTGGGGAGGGGGGCGAGG - Exonic
1067227434 10:44385125-44385147 GAGGGGAGAGCCAGGCGGGGCGG + Intronic
1067285518 10:44904938-44904960 GAGGGATGATGCTGGAGGCTGGG + Intergenic
1067471532 10:46541599-46541621 GAGGGGTGGGGTGGGCGGAGGGG + Intergenic
1067684187 10:48457299-48457321 GTGGGGTGAAGCAGGCGGCCCGG - Intronic
1069555108 10:69392622-69392644 GTGGGGTGAGGGTGGCTGGGCGG + Intronic
1069592379 10:69650136-69650158 GAGGGGTGAGGGTGGCTCAGTGG + Intergenic
1069952749 10:72030990-72031012 GTGGGGTGAGGCGGGAGGTGAGG - Intergenic
1069958677 10:72067192-72067214 GAGGGCTGGGGCTGATGGCGAGG - Intronic
1070162524 10:73874614-73874636 GCGGGGCGGGGCGGGCGGCGCGG - Intergenic
1070504208 10:77098864-77098886 GAGGGGTGAGGGTGTTGGGGAGG - Intronic
1070954260 10:80454219-80454241 GAGGGGCGGGGCCGGAGGCGCGG - Exonic
1071320607 10:84452823-84452845 GTGGGGGGAGGGGGGCGGCGGGG - Intronic
1071759277 10:88582848-88582870 AAGGGGCGAGGGTGGGGGCGAGG - Intronic
1072892560 10:99337366-99337388 GAGCGATGAGGCTGGAGGGGAGG - Intronic
1074546473 10:114404999-114405021 GAGGGGCGAGGAGGGCAGCGGGG + Intergenic
1075078651 10:119368366-119368388 GCGGGGTGGTGCTGGGGGCGGGG + Intronic
1075178393 10:120187124-120187146 GAGGCCTGAGGCTGGAGGCAGGG + Intergenic
1075504357 10:123009007-123009029 GAGCGGAGAGGCCTGCGGCGAGG + Exonic
1075627295 10:123972430-123972452 GAGGGGTGGGGATGGAGGGGTGG + Intergenic
1076581361 10:131514054-131514076 GCGGGGTGAGGCAGGCGTTGGGG - Intergenic
1076888870 10:133274457-133274479 GAGGGTGGAGGGTGGAGGCGGGG + Intronic
1077077700 11:708881-708903 GAGAGGTGAGGCTGGAGTTGGGG - Intronic
1077079703 11:719802-719824 GGCGGGTGAGGATGGTGGCGCGG + Intronic
1077104463 11:836174-836196 GAGGGGTGGGGGTGGGGGTGGGG - Intronic
1077105855 11:842396-842418 GAGGGGTGAGGCGCGGGCCGGGG - Exonic
1077138424 11:1012955-1012977 GAGGGCAGAGGGTGGCAGCGAGG - Exonic
1077213234 11:1383056-1383078 GGGGTGTGAGGCTGGCTGGGAGG + Intergenic
1077425290 11:2473207-2473229 AAGGGGTGGGGCTGGCAGGGAGG + Intronic
1079135665 11:17774871-17774893 GAGGGATGAGGCTGGAGCCTCGG - Intronic
1080374184 11:31688302-31688324 CAGGGGTGAGGATGGAGGTGGGG - Intronic
1080609030 11:33887963-33887985 GTGGGGAGAGGCTGGAGGTGAGG + Intronic
1080893720 11:36431609-36431631 GAGGGATGAGGGTGGCGGTTGGG + Intronic
1081649926 11:44817056-44817078 GAAGTGTGAGGCTGGAGGCGAGG + Intronic
1081664061 11:44906307-44906329 CAAGGGTGGGGCTGGCTGCGGGG + Intronic
1081763161 11:45591221-45591243 GAGTGGTTAGGATGGCGGCAAGG + Intergenic
1081977042 11:47242311-47242333 GAGGGAAGAGGCTGGTGGCTGGG + Intronic
1082767405 11:57180491-57180513 GAGGGCTGAGGCTCTGGGCGTGG + Intergenic
1082780022 11:57280021-57280043 CAGGTGTGAGGCTGGGGGTGGGG + Intergenic
1082807487 11:57460188-57460210 GAGGGACGCGGCTGGGGGCGGGG + Intergenic
1083274372 11:61588381-61588403 GAGGGTTGAGGCGAGGGGCGTGG + Intergenic
1083656938 11:64234458-64234480 GGGGGGCGAGGCCGTCGGCGGGG - Intergenic
1083718503 11:64592463-64592485 GAGGGGTGAGGGTGTCAGCTTGG + Intronic
1083746807 11:64741552-64741574 GTGGAGGGAGGCTGGGGGCGGGG + Intronic
1083881094 11:65548641-65548663 GAGGGGAGAGGCTGGAGGCAGGG - Intronic
1084001105 11:66295768-66295790 CAGGGGTGAGGGTGGGGGTGGGG + Exonic
1084087099 11:66859780-66859802 CAGGGGCGAGGCCGGCAGCGTGG - Exonic
1084285579 11:68128540-68128562 GAGGGGCGGGGTTGGCGGCGAGG + Intergenic
1084611962 11:70208975-70208997 GAGGGGTGAGGCTGAGGCTGGGG - Intergenic
1084739793 11:71132177-71132199 AAGGGTGGAGGCTGGCGGGGAGG + Intronic
1084748125 11:71186259-71186281 TAGGGGTGAGGCTGGGGCTGGGG - Intronic
1084888131 11:72223846-72223868 GCGGGGCGGGGCGGGCGGCGCGG + Intronic
1085344991 11:75762950-75762972 GTGGGGTGAGGGTGGGGGAGGGG - Intronic
1085515386 11:77108487-77108509 GAGGGATGAGGCTGAGAGCGTGG + Intronic
1088522288 11:110712521-110712543 GAGGGCTGAGGAGGGCTGCGGGG - Intronic
1088561503 11:111120469-111120491 GACTGGAGAGGCTGGCGGGGGGG - Intergenic
1088972496 11:114786357-114786379 GTGGGGTGGGGCGGGGGGCGGGG - Intergenic
1088985736 11:114906214-114906236 GAAGGGTGGGGGTGGGGGCGGGG + Intergenic
1089302509 11:117507276-117507298 GAGGGGTGCGGCTGGTGCCTGGG - Intronic
1089346977 11:117796967-117796989 GGGTGGCGCGGCTGGCGGCGAGG - Intronic
1089351831 11:117825684-117825706 GAGTGGGGAGGCTGCCTGCGAGG - Intronic
1089535465 11:119158335-119158357 GAGGCGTCAGGCTGGGGGAGAGG + Intronic
1089660179 11:119980614-119980636 GTGGGGTGTGGCTGGAGGAGCGG + Intergenic
1090074477 11:123571349-123571371 GGGGGGTGAGGGTGGGGGCAGGG + Intronic
1090239326 11:125170967-125170989 GAGGGGGGAGGCTGGGGTGGAGG + Intronic
1090298852 11:125616169-125616191 GAGGGGTGAGGATAGGGGTGGGG - Intronic
1090542666 11:127726090-127726112 GAGGTCTGAGCCTGGAGGCGTGG + Intergenic
1090902788 11:131047258-131047280 AAGGAGTGAGGCTGGGGTCGGGG + Intergenic
1091000916 11:131910507-131910529 GAGCGGGCGGGCTGGCGGCGCGG - Intronic
1091550196 12:1530718-1530740 GGGGCGCGGGGCTGGCGGCGCGG - Intronic
1091875526 12:3930338-3930360 GCGGGCTGAGGCTGGCGGGGGGG + Intergenic
1092170961 12:6373938-6373960 GAGGGGTGAGGCTAGGTGAGGGG - Intronic
1092229126 12:6766997-6767019 GAGGGGTGGGGACGGCTGCGGGG - Intronic
1092964287 12:13626810-13626832 GAGGGGGGAGGGTGGGGGGGAGG - Intronic
1095962511 12:47844467-47844489 GAGGGCAGAGGCTGGAGGCAGGG - Exonic
1096268454 12:50143709-50143731 GAGGGGTAAGGGTGGCTGCTGGG + Intronic
1096285810 12:50299225-50299247 GAGGGGTGGGGGTGGGGGTGGGG - Intergenic
1096468733 12:51863547-51863569 AAGGGGTGGGGCTGGCGAGGAGG + Intergenic
1096977518 12:55707943-55707965 GAGGGGCGGGGCCGGAGGCGGGG - Intronic
1097186204 12:57197859-57197881 GAGACATGAGGCTGGCAGCGAGG - Intronic
1098105892 12:67069032-67069054 GAGAGGTGAGCCAGGCGGCGGGG - Intergenic
1098243059 12:68487910-68487932 CAGGGAAGAGGCTGGCGGAGGGG - Intergenic
1099948301 12:89270954-89270976 GAGGGAGGAGGCTGGGGGCGGGG + Intergenic
1100391368 12:94148621-94148643 GAGGAGCGAGGCGGGCGGGGAGG - Intergenic
1100474356 12:94922037-94922059 CAGGGGTGAGGTAGGTGGCGGGG - Intronic
1101131731 12:101697606-101697628 GAGGGGTCCGGCTGGGGGCGGGG - Exonic
1101131793 12:101697771-101697793 GGAGGGAGAGGCTGGCGGCCGGG - Exonic
1101858633 12:108464602-108464624 GAGGGGTGAGACTGGCCTCAGGG - Intergenic
1102931388 12:116865029-116865051 GAGGGGGGAGGCGGGCAGAGAGG + Intronic
1102955982 12:117059266-117059288 GAGGGGTGGGGATGGAGGCATGG + Intronic
1103360465 12:120350577-120350599 GAGGGGAGAGTCTGGGGGTGGGG + Intronic
1103809438 12:123601952-123601974 GACGGTGGAGGCAGGCGGCGGGG - Intergenic
1104739933 12:131164792-131164814 GAGAGGTGCGGCCCGCGGCGGGG - Intergenic
1104792546 12:131493173-131493195 GAGAGGTGCGGCCCGCGGCGGGG + Intergenic
1104845302 12:131843941-131843963 GTGGGGGGAGGCGGGCGTCGGGG + Intronic
1104929293 12:132329635-132329657 GAGGGGTGGGGGAGGCGGGGCGG - Intergenic
1105514246 13:21076151-21076173 GAGGGGTGAGGGTGGAGGAGGGG - Intergenic
1108506109 13:51113858-51113880 GAGGGGCTAGGCTGGGGGAGAGG - Intergenic
1111950911 13:94708321-94708343 GAGGGGTGAGGATGCCGAGGGGG - Intergenic
1112461392 13:99606551-99606573 GCGGGGTGTGGCTGGCGGGACGG + Intergenic
1113542016 13:111115910-111115932 GAGGGGCGGCGCGGGCGGCGGGG + Intronic
1113794531 13:113049349-113049371 GGGTGGTGGGGCTGGCGGGGAGG + Intronic
1113841557 13:113364171-113364193 GAGGGGCGGGGCTGGAGGCGGGG + Intergenic
1113841676 13:113364405-113364427 GAGGGGCGGGGCTGGGGGGGCGG + Intergenic
1113909820 13:113836571-113836593 GAGGGGTGAGGGAGGGGGTGGGG + Intronic
1113909832 13:113836593-113836615 GAGGGGTGAGGGAGGGGGTGGGG + Intronic
1115119971 14:29927542-29927564 GAGGGCGGGGGCTGGCGGCGCGG + Exonic
1115197023 14:30812332-30812354 GAGGGGTGGGGAAGGGGGCGCGG + Intergenic
1115431899 14:33329213-33329235 GTGGGGTGGGGCTGGGGGCAGGG - Intronic
1115752477 14:36506007-36506029 GAGGGTGGGGGCTGGGGGCGGGG + Intronic
1117383840 14:55191832-55191854 GAGGGGTGAGGCTGGGTCCCTGG + Intergenic
1118210532 14:63761944-63761966 ACGGGGTGACGCTGGCTGCGGGG + Intergenic
1119208482 14:72812240-72812262 GATGGGAGAGGCTGGGGGCCGGG - Intronic
1119759435 14:77140775-77140797 GAGGGCTGAGCACGGCGGCGGGG - Intronic
1121183604 14:91947763-91947785 GCGGGGCGGGGCTGGCAGCGCGG + Exonic
1121249492 14:92489057-92489079 GAAGGGTGAGGCCAGGGGCGGGG + Intronic
1121308599 14:92923018-92923040 GAGGGGTGAGGTTAGAGGTGGGG + Intergenic
1121448805 14:93995126-93995148 TGGCGGTGAGGCTGGCAGCGTGG - Intergenic
1121468273 14:94129676-94129698 GCGGGGTGGGGCGGGGGGCGGGG - Intronic
1121617004 14:95319952-95319974 GCGGGGAGGGGCGGGCGGCGCGG + Intergenic
1121691838 14:95883726-95883748 GAAGGGTCAGAGTGGCGGCGGGG - Intergenic
1122066007 14:99174942-99174964 GAAGCGTGCGGCGGGCGGCGGGG - Exonic
1122094473 14:99361216-99361238 CAGGGGTGTGGCTGTGGGCGAGG + Intergenic
1122118981 14:99541822-99541844 GAAGGTGGAGGCTGGGGGCGAGG + Intronic
1122264541 14:100540464-100540486 GCGGGGTGGGCCTGGCTGCGGGG + Intronic
1122278807 14:100609572-100609594 GAGGGGTGAGGGTGGCGGGGGGG + Intergenic
1122713585 14:103679218-103679240 AGGGGGTGAGGGTGGAGGCGGGG - Intronic
1122814142 14:104304034-104304056 GTGGGGTGGGGCTGGAGGCTGGG - Intergenic
1122878423 14:104679260-104679282 GAGGGGAGTGGCTGGCAGCCAGG - Intergenic
1122910747 14:104826647-104826669 GAGGGGCGGGGCTGCCGGAGGGG + Intergenic
1122910755 14:104826664-104826686 GAGGGGCGGGGCTGCCGGAGGGG + Intergenic
1123123391 14:105928448-105928470 GTGGGGTGGGGCTGAGGGCGTGG + Intronic
1123406036 15:20019952-20019974 GTGGGGTGGGGCTGAGGGCGTGG + Intergenic
1123515365 15:21026600-21026622 GTGGGGTGGGGCTGAGGGCGTGG + Intergenic
1124029888 15:26001183-26001205 GAGGGCTGAGGCCGGGGGCCAGG - Intergenic
1124550702 15:30678613-30678635 GAGAGGTGAGGCTGACTGAGAGG - Intronic
1124680546 15:31726998-31727020 GAGAGGTGAGGCTGACTGAGAGG + Intronic
1124883308 15:33661542-33661564 GGTGGGTGAGGCTGGGGGAGGGG + Intronic
1124971174 15:34490656-34490678 GAGCGATGAAGATGGCGGCGGGG - Intergenic
1125523946 15:40363862-40363884 AAGGGCTGAGGCTGGAGCCGTGG - Exonic
1125834456 15:42737161-42737183 GAGGGGCGGGGCCGGCGGCGGGG + Intergenic
1125852710 15:42920364-42920386 GAGGGGTGCGGCCGGAGGAGGGG + Intronic
1125929388 15:43589760-43589782 GAGGGGTGGGGCTGGAGTCCAGG - Intronic
1125942555 15:43689592-43689614 GAGGGGTGGGGCTGGAGTCCAGG - Intergenic
1125956041 15:43792053-43792075 GAGGGGTGCGGCTGGCGATGTGG - Intronic
1126495404 15:49284499-49284521 GAGGACTGAGGCTGGAGGCTAGG + Intronic
1127306074 15:57706815-57706837 GCGGGCTGAGGCTGGCGCGGCGG - Exonic
1128347834 15:66865805-66865827 GAGGGGTGGGGCTGGGGAAGAGG - Intergenic
1128741767 15:70088880-70088902 GCGGGGTGGGGGTGGGGGCGGGG - Intronic
1128943838 15:71808701-71808723 GAGGGGTGAGGACGGAGGAGAGG + Intronic
1129258395 15:74347823-74347845 GAGGGCAGAGGCTGGGGGTGAGG - Intronic
1129265675 15:74391995-74392017 GAGGGCAGAGGCTGGAGGTGTGG - Intergenic
1129661106 15:77553652-77553674 GAGGGGACAGGCTGCCGGTGGGG - Intergenic
1129692309 15:77720890-77720912 GAGGGATGAGGGAGGCGGGGAGG - Intronic
1130032917 15:80332329-80332351 GAAGGGTGAGGGTGGCTCCGTGG + Intergenic
1130040903 15:80404564-80404586 GCGGGCTGCGGCGGGCGGCGGGG - Intronic
1130871223 15:87973804-87973826 GAGGGGCGATGCTGGCTGCTTGG - Intronic
1131199992 15:90388205-90388227 GCGGGGTGGGGCTGACGGCACGG + Exonic
1131888645 15:96948012-96948034 GCGCGGGGAGGCGGGCGGCGCGG - Intergenic
1132519453 16:380800-380822 GAGGGGAGGGGCTGGGGGCCGGG + Intronic
1132656139 16:1042747-1042769 AAGGGGTGGGGCGGGTGGCGTGG + Intergenic
1132833880 16:1942921-1942943 GAGTGGGGAGCCTGGGGGCGAGG - Intronic
1132834605 16:1946547-1946569 GTGGGGTCAGGCTGGCCGGGGGG - Intronic
1132989891 16:2787147-2787169 GAGGGGTGAGGATGAGGGAGGGG - Intronic
1133042797 16:3069388-3069410 GAGGGGTCAGGGTGGGTGCGCGG - Exonic
1133044838 16:3082030-3082052 GAGGGGTCAGGGTGGGTGCGCGG - Intronic
1133230871 16:4365918-4365940 GAGAGGTGAGGCCGGAGGCGAGG + Intronic
1133267499 16:4593888-4593910 GAGGGGTGGGGCTGGCACCCAGG - Intronic
1133924116 16:10180575-10180597 GAGGGATGTGGATGGCGTCGGGG - Intronic
1133938938 16:10292413-10292435 CAGCAGTGAGGCTGGGGGCGGGG - Intergenic
1134276612 16:12782038-12782060 GAGGTGTGAGGCTGGGGGTGGGG + Intronic
1134480080 16:14611771-14611793 GAAGGCTGAGGCAGGCGGTGAGG - Intronic
1135047762 16:19168663-19168685 TAGGGCTGAGGCTGGGGGCAAGG + Intronic
1135285237 16:21187612-21187634 GAGGGTTGGGGCGGGGGGCGGGG - Intergenic
1136138867 16:28276062-28276084 GAGGAGGGAGGCTGGAGGAGGGG + Intergenic
1136237744 16:28925051-28925073 GAACGGTGATGCTGGGGGCGGGG - Intronic
1136295826 16:29301578-29301600 GAAGTGTGGGGCTGGCAGCGTGG + Intergenic
1136540270 16:30924543-30924565 AGAGGGTGAGGCTGGGGGCGGGG - Intronic
1136616645 16:31402280-31402302 GACGGGGGAGGCTGGCCTCGGGG + Intronic
1136724812 16:32349007-32349029 GAGGGGCGAGGCGGGGCGCGCGG - Intergenic
1137293168 16:47065999-47066021 GAGGAGTGAGACTGGTGGCAAGG + Intergenic
1137592527 16:49702533-49702555 GAGGGGGCAGGGTGGAGGCGGGG + Intronic
1137644593 16:50063107-50063129 AAGAGGTGAGGCTGGGGGCCGGG + Intergenic
1137697302 16:50469716-50469738 GAGGGGTGAGGGTGAGGGAGAGG + Intergenic
1137752874 16:50879876-50879898 GAGGGGCGTGGATGGGGGCGGGG - Intergenic
1138062931 16:53910422-53910444 GAGAGGAGAGGCTGGAGGCATGG + Intronic
1138515921 16:57535628-57535650 GAGGGGTGGGGCTGGGGTCGGGG - Intronic
1139659649 16:68411941-68411963 GAGGGGAGAGGCTGGGGTGGGGG + Intronic
1140214514 16:72996618-72996640 GCGGGGAGGGGCTGGGGGCGTGG + Intronic
1140416449 16:74777051-74777073 GAGGGGTGGGGTTGGGGGCGTGG + Intergenic
1140946201 16:79770560-79770582 GCGGGGCGGGGCTGGGGGCGCGG - Intergenic
1141033181 16:80607179-80607201 GCGGGGTGAGGGTGACGGTGGGG - Intronic
1141143665 16:81514243-81514265 GAGGGGTGGGGCAGGCAGGGAGG + Intronic
1141815848 16:86408825-86408847 GGGAGGTGAGGCTGGAGGGGAGG - Intergenic
1141861095 16:86716923-86716945 CAGGGGTGAGGCCAGAGGCGTGG + Intergenic
1141884083 16:86879914-86879936 GAGGGGTGAGCCTGGCAGTTAGG - Intergenic
1142034273 16:87854080-87854102 GCAGGGTCAGGCTGGCGGTGGGG - Intronic
1142051198 16:87959487-87959509 GAGGTGTGAGGCTGCTTGCGAGG + Intronic
1142101745 16:88275765-88275787 GAAGTGTGGGGCTGGCAGCGTGG + Intergenic
1142126505 16:88413257-88413279 GGGTGCTGAGGCTGGCGGCCTGG + Intergenic
1142138170 16:88461009-88461031 GAGGGGTGGGGCGGGAGGCCTGG + Intronic
1142232327 16:88905698-88905720 GAGGGGCGGGGCTGGAGGGGCGG + Intronic
1142267352 16:89070735-89070757 GCGGGGTGAGGGCGGCAGCGGGG - Intergenic
1142267416 16:89070931-89070953 GGGGGGTGAGGGCGGCGGTGGGG - Intergenic
1142267426 16:89070951-89070973 GAGGGTTGAGGGCGGCGGCGGGG - Intergenic
1142267443 16:89070991-89071013 GGGGGTTGAGGACGGCGGCGGGG - Intergenic
1142287794 16:89178477-89178499 GAAGAGTGAGGCTGGGGGTGGGG + Intronic
1142375850 16:89706845-89706867 GTGGGGTGAGGCTGGGGTCCAGG - Intergenic
1142413159 16:89926255-89926277 GCGGGGCGGGGCTGGGGGCGGGG + Intronic
1203001618 16_KI270728v1_random:168748-168770 GAGGGGCGAGGCGGGGCGCGCGG + Intergenic
1203133221 16_KI270728v1_random:1705154-1705176 GAGGGGCGAGGCGGGGCGCGCGG + Intergenic
1142509353 17:384805-384827 GAGGGGGGCGGCTGGCGGGGAGG + Intronic
1142967589 17:3590946-3590968 CAAGGGTGAGGAGGGCGGCGGGG - Exonic
1143189560 17:5031734-5031756 GAGGTGCGAGGCGGGCGGGGCGG + Intergenic
1143201478 17:5116311-5116333 GAGTGGTGAGGCGGGCCGCCGGG - Intronic
1143371635 17:6444236-6444258 GAGCCACGAGGCTGGCGGCGGGG + Intergenic
1143448850 17:7023855-7023877 GAGGGGTGGGGCCTGGGGCGGGG + Intronic
1143477478 17:7211122-7211144 GAGGGGTGGGGGTGGGGGCGGGG + Intronic
1143503436 17:7351693-7351715 GAGGGGTGGGGCTGGCCCTGGGG + Intergenic
1143587002 17:7855329-7855351 GTGTGGTGATGCTGGCGGTGGGG + Intronic
1143633148 17:8150192-8150214 GTCGGGTGAGGCTGGAGGAGAGG - Intronic
1144565163 17:16353549-16353571 GCGGGGCGCGGCTGGCGGAGCGG - Intronic
1144755969 17:17681139-17681161 GTGGGGTGAGGGTGGGGGCCTGG + Intergenic
1144770728 17:17758008-17758030 GAGAGATGAGGGTGGGGGCGAGG - Intronic
1145035516 17:19537782-19537804 GAGAGATGAGGCTGGAGGCCTGG - Intronic
1145065709 17:19760024-19760046 GAGGGGTGGGGCGTGGGGCGGGG - Intergenic
1146403611 17:32519280-32519302 GCCGGGTGGGGGTGGCGGCGAGG + Intronic
1146581352 17:34040728-34040750 GAGAGGTGAGGCTGGGGAAGGGG - Intronic
1146656028 17:34635880-34635902 GAAGGGTGAGGCAGGCTGGGAGG - Intronic
1147132841 17:38419214-38419236 GAGGGGCGGGGCCGGCGGGGCGG + Intergenic
1147134731 17:38428404-38428426 GAGGGGCGGGGCCGGGGGCGGGG - Exonic
1147164665 17:38586893-38586915 GAGCGGTGAGGCTGGGGGCCTGG + Intronic
1147185358 17:38710490-38710512 AAGGGCTGAGGCTGGTGGCCGGG + Intronic
1147947248 17:44086974-44086996 GAGGGGTGGGGGCGGGGGCGGGG + Intronic
1148081221 17:44968441-44968463 TAGGGGTGGGGCTGCGGGCGGGG + Intergenic
1149855415 17:60078652-60078674 GAGGGGTGGGGCCGGGGCCGGGG + Intronic
1150287337 17:63961719-63961741 CAGGGGTGGGGCTGTAGGCGGGG - Intronic
1150650061 17:67004370-67004392 GAGGCGTGAGGCTGGTGCTGTGG + Intronic
1151202189 17:72476681-72476703 GAGGAGTGAGGTGGGGGGCGGGG + Intergenic
1151513622 17:74578168-74578190 GAAGGGTGAGGCTGGGGGTGGGG + Intergenic
1152067296 17:78118843-78118865 GTGGAGTGGGGCTGGCGGCTCGG - Intronic
1152197901 17:78928346-78928368 GAGGGCTGAGGCAGGAGGCCAGG + Intergenic
1152233347 17:79125765-79125787 TGGGAGTGAGGCTGGTGGCGAGG + Intronic
1152460772 17:80441308-80441330 GAGGAGTGAGGCTGGAGGAGAGG - Intergenic
1152481377 17:80555881-80555903 GAGGGGCGAGACTGGAGGTGGGG + Intronic
1152660557 17:81540042-81540064 GAGGGAGGAGGCTGGGGGCTGGG + Exonic
1152697570 17:81804502-81804524 GGGGGGCGCGGCTGGGGGCGGGG + Intronic
1152940882 17:83172469-83172491 GTGGGGTGAGGGGTGCGGCGAGG + Intergenic
1152940894 17:83172507-83172529 GTGGGGTGAGGGGTGCGGCGAGG + Intergenic
1152940973 17:83172807-83172829 GTGGGGTGAGGGGTGCGGCGAGG + Intergenic
1152940985 17:83172845-83172867 GTGGGGTGAGGGGTGCGGCGAGG + Intergenic
1152941029 17:83172995-83173017 GTGGGGTGAGGGGTGCGGCGAGG + Intergenic
1152941080 17:83173184-83173206 GTGGGGTGAGGGGTGCGGCGAGG + Intergenic
1152941092 17:83173222-83173244 GTGGGGTGAGGGGTGCGGCGAGG + Intergenic
1152941146 17:83173412-83173434 GTGGGGTGAGGGGTGCGGCGAGG + Intergenic
1154210922 18:12377589-12377611 GGGGGGCGTGGCTGGAGGCGGGG + Intergenic
1154216609 18:12420651-12420673 GCGGGGTGGGGGTGGCGGTGGGG + Intronic
1157664060 18:49470335-49470357 GCAGGGTGAGGCTTGCGGGGTGG - Intergenic
1157680503 18:49601884-49601906 GAGGGGAGAGGCTGGGGGTGGGG + Intergenic
1158259022 18:55587852-55587874 GGGCGGGGGGGCTGGCGGCGAGG + Intronic
1158468432 18:57712700-57712722 GAGCAGTGAGGTTGGCGGGGAGG - Intronic
1158515289 18:58125596-58125618 GAGTGGAGAGGCTGGCAGTGGGG - Intronic
1159040758 18:63320610-63320632 GAGGGGGGCGGCTGGCGGGAGGG + Intergenic
1160148774 18:76384317-76384339 GAGGGGTGGGGGTGGTGGAGGGG - Intronic
1160749668 19:727900-727922 GGGGGCAGAGGCTGGCTGCGTGG + Intronic
1160826318 19:1082125-1082147 CAGGGCTGAGGCTGGGGGCGTGG + Intronic
1160826510 19:1082756-1082778 TGGGGCTGAGGCTGGGGGCGTGG + Intronic
1160828533 19:1091754-1091776 AGGGGGAGAGGCTGGCGGGGTGG + Intronic
1160864933 19:1252297-1252319 GAGGGCTGGGGGTGGCGGCTTGG + Intronic
1161061676 19:2218185-2218207 GAGGAGTGAGGCTGGGAGCCAGG - Intronic
1161083893 19:2325119-2325141 GAGGGGTGGGGCAGGCAGCGTGG - Intronic
1161188551 19:2939468-2939490 GAGGGGTGAGGCTGACAGCCTGG + Intronic
1161210363 19:3062430-3062452 GAGCGGGGAGGCGGGCGGCGGGG - Intronic
1161537900 19:4831346-4831368 GAGGGGTCAGGCTGTCGGGGAGG + Intronic
1161594539 19:5144420-5144442 GTGGGGTGGGGCAGGGGGCGGGG + Intronic
1161642061 19:5430395-5430417 GAGGTGGGAGGTTGGGGGCGTGG + Intergenic
1161652357 19:5493071-5493093 GCGAGGGGAGGCTTGCGGCGGGG + Intergenic
1161698649 19:5783683-5783705 GGGGGGTGGGGGTGGCAGCGGGG + Exonic
1161739590 19:6012572-6012594 GGGGGGTGATGCTGGCTCCGCGG + Intronic
1161755815 19:6133782-6133804 CAGGGGTGAAGCTGGAGGGGAGG - Intronic
1161845008 19:6707360-6707382 GAGGGGAGGCCCTGGCGGCGGGG - Intronic
1161852709 19:6746017-6746039 GGGGGGCGAGGCTACCGGCGGGG - Intronic
1161853798 19:6752787-6752809 GAGGGGCGAGGCGGGCGCCTGGG - Intronic
1162059561 19:8086335-8086357 GAGGGGTGAGGCAGGTGGGCGGG + Intronic
1162172809 19:8804732-8804754 GAAGGGTGAAGCTGGGGGTGAGG - Intergenic
1162479650 19:10920991-10921013 GAGGGGCCAGGCCTGCGGCGAGG - Intronic
1162797622 19:13095044-13095066 AAGGGGTGAGGGTGGAGGCCAGG - Exonic
1163370258 19:16897475-16897497 GAGGGGCGTGGCTGGGGGAGTGG - Intronic
1163446192 19:17347761-17347783 GAGGGATGAGGCTGGGAGAGAGG + Intergenic
1163582633 19:18147569-18147591 GAGTGGTGGGGCTGGGGGAGAGG - Exonic
1163648614 19:18504203-18504225 GAGGGGTGAGGCTGAGGAGGAGG + Intronic
1163664682 19:18597832-18597854 GAAGAGTGAGGCAGGCTGCGGGG + Intronic
1163695075 19:18759949-18759971 ATGGGGCGGGGCTGGCGGCGGGG - Intronic
1164649710 19:29882913-29882935 GAGGGGTGGGGTTGGAGGGGTGG + Intergenic
1164693284 19:30226241-30226263 GAGGGGGTAGGCTGGGGCCGCGG + Intergenic
1165258144 19:34592383-34592405 GGGGAGTGAGGCTGGAGGCAGGG + Intergenic
1165265919 19:34663964-34663986 GAGGGGTGGGGTGGGCGGGGAGG - Intronic
1165391723 19:35542875-35542897 GAGGGGTAAGGGTGGAGGGGTGG + Intronic
1165412913 19:35673348-35673370 GAGGGGCGAGGGTCCCGGCGCGG + Intronic
1165418670 19:35711524-35711546 AATGGGTGAGGCTGGTGGAGGGG - Intronic
1165444859 19:35851168-35851190 GAGAGGAGAGGCTGGGGGCTTGG + Intronic
1165469557 19:35995517-35995539 GACCGGGGAGCCTGGCGGCGTGG + Exonic
1165490601 19:36120941-36120963 TAGGGGTGAGGCTGGGAGTGGGG + Intronic
1165503955 19:36212819-36212841 TAGGGGTGAGGGTGGTGGTGGGG + Intronic
1165749459 19:38251350-38251372 GGGGGCTGAGGCTGCCGTCGTGG + Exonic
1165808449 19:38596244-38596266 GAGGGGCGGAGCTGGAGGCGGGG - Intronic
1165862158 19:38914996-38915018 GAGGGGTGAGGCTGGGGCTGGGG + Intergenic
1165873972 19:38992683-38992705 GAGGGGTGAGGGAGGAGGAGAGG + Intronic
1166067002 19:40365935-40365957 GTGGGGGGAGGCTGGCTGGGGGG + Intronic
1166094194 19:40529455-40529477 GAGGGGCGGGGCGGGCGGTGGGG + Intronic
1166107285 19:40603717-40603739 GAGGGAGGAGGCAGGCGGCCGGG - Intronic
1166307780 19:41944765-41944787 GAGTTCTGAGGCTGGGGGCGTGG - Intergenic
1166525990 19:43510104-43510126 GAGAGGTGAGGCTGGATGAGAGG - Intronic
1166547011 19:43639844-43639866 GGGGGGCGGGGCGGGCGGCGCGG - Intergenic
1166547092 19:43640013-43640035 GAGGGGTGAGGAGGGCGGGAAGG + Intergenic
1166714045 19:44955352-44955374 ACGGGGCGGGGCTGGCGGCGGGG + Exonic
1166835283 19:45664037-45664059 GAAGGGAGAGGCTGGCAGGGAGG - Intergenic
1166885682 19:45959664-45959686 GAGATGGGAGGCTGGGGGCGGGG + Intronic
1166981273 19:46633656-46633678 GAGGAGAGAGGATGGCGGAGGGG + Intergenic
1166995794 19:46719190-46719212 GATGTGTGAGGGTGGTGGCGAGG - Intergenic
1167249319 19:48392134-48392156 GAGGGAGGAGGCTGGGGGCCTGG - Intergenic
1167249332 19:48392169-48392191 GAGGGAGGAGGCTGGGGGCCTGG - Intergenic
1167276659 19:48543956-48543978 GAGGGAGGAGGCTGGGGGCCTGG - Intergenic
1167276685 19:48544028-48544050 GAGGGAGGAGGCTGGGGGCCTGG - Intergenic
1167276736 19:48544174-48544196 GAGGGAGGAGGCTGGGGGCCTGG - Intergenic
1167390288 19:49190339-49190361 GAGTGGTGGGGATGGGGGCGGGG + Intronic
1167537754 19:50065819-50065841 GAGGGGTAAGTCTGGGGGCCAGG + Intergenic
1167641914 19:50686952-50686974 GAGGGGCGAGTCCGCCGGCGGGG + Intronic
1167689166 19:50975009-50975031 GGGAGGAGGGGCTGGCGGCGGGG + Intergenic
1167716297 19:51144602-51144624 GACAGGTGAGGCTGGTGCCGTGG - Exonic
1167762318 19:51457521-51457543 GACAGGTGAGGCTGGTGCCGTGG + Exonic
1167770044 19:51509235-51509257 GACAGGTGAGGCTGGCGTCGTGG - Intergenic
1167915881 19:52739811-52739833 GAGGGAGGAGGCTGGAGGCCAGG - Intergenic
1168282772 19:55314404-55314426 GAGGAGTGAGGCTGCTGGCAGGG - Intronic
1168351725 19:55679918-55679940 GAGGGATGGGGCTGGAGGGGTGG + Intronic
1168577932 19:57528513-57528535 GAGGGCTGAGGCTGGAGGCTGGG + Intronic
925296126 2:2778810-2778832 GAGGGGTGAGGTGGGCAGGGAGG - Intergenic
925533249 2:4887435-4887457 GTGGGGTGTGGCTGGAGGGGAGG + Intergenic
926109112 2:10170805-10170827 AAGGGCTGTGGCTGGGGGCGGGG - Intronic
926395245 2:12434658-12434680 GAGAGGAGAGGCTGGCAGGGGGG + Intergenic
927138847 2:20116011-20116033 GAGGGCTGAGGCTGTCAGGGTGG + Intergenic
927552180 2:24010188-24010210 GAGAGGTGAGCGGGGCGGCGGGG + Exonic
927652371 2:24920262-24920284 GAGGCGGGAGGCGGGCGGGGCGG + Intergenic
927881388 2:26692549-26692571 GAGGAGGGGGGCTGGCGGAGGGG - Intergenic
928135988 2:28687866-28687888 GGGGTGTGAGGCTGGAGACGGGG - Intergenic
928168987 2:28991437-28991459 GAGGGGTGAGCCAGGCTGAGGGG - Intronic
929033666 2:37671694-37671716 GCGGGGCGGGGCCGGCGGCGCGG + Exonic
929597807 2:43187144-43187166 GAGGGGAGAGGCTGAGGGCCGGG - Intergenic
931440676 2:62288034-62288056 GAGGGGTGGGGCTGGTGGCAGGG + Intergenic
932607351 2:73174383-73174405 GAGTAGTGAGGATGACGGCGAGG + Intergenic
932812147 2:74834510-74834532 GAGAGGGGAGGCGGGCGGCGCGG - Exonic
934604156 2:95681625-95681647 GCAGGGTGAGGCTGGGGGCTGGG + Intergenic
934665037 2:96163970-96163992 GGGGGCGGAGGCTGGGGGCGCGG - Intergenic
934974062 2:98787936-98787958 GGGGGCTGAGGCTGGCGATGCGG + Intergenic
935592495 2:104855402-104855424 GAGGCGGGAGGCGGGGGGCGCGG + Intergenic
936117672 2:109714966-109714988 GGGGGGTGGGGGTGGGGGCGGGG + Intergenic
936537546 2:113323859-113323881 GCAGGGTGAGGCTGGGGGCTGGG + Intergenic
937252436 2:120533437-120533459 GAGGGGAGGGGCTGGCGGGCTGG - Intergenic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
938581370 2:132649326-132649348 GAGTGGTGAGGCTGGGGCAGAGG + Intronic
941580725 2:167293209-167293231 GAGAAGTGATGCTGGCGCCGGGG + Intergenic
941956655 2:171212262-171212284 AAGGGGTGAGGGTGGGGGCAGGG - Intronic
943593784 2:189830938-189830960 GAGGGGTGAGCCTGGCCACTTGG + Intronic
945016563 2:205524745-205524767 GAAGGGTGAGGCTGGAGGAGAGG - Intronic
945225913 2:207530586-207530608 CGGGGGCGAGGCGGGCGGCGGGG - Intronic
946041973 2:216790539-216790561 GAGGTGGGAGGCGGGAGGCGGGG - Intergenic
946340034 2:219060762-219060784 GCGGGGGGCGGCGGGCGGCGGGG + Intergenic
946386620 2:219387822-219387844 GAGGGGCGGGGCAGGCGGCGCGG - Exonic
947666562 2:231909710-231909732 GAGGGCTGAGGGTGGGGGTGGGG - Intergenic
947741278 2:232486128-232486150 CGGGGGTGGGCCTGGCGGCGCGG - Exonic
947949617 2:234135965-234135987 GACCAGTGAGGCTGGCGGTGGGG + Intergenic
948780545 2:240319096-240319118 GAGGGGTGAGGCTGGAGGAGGGG + Intergenic
948988738 2:241541333-241541355 GAGGGGTGGGGCTGCCTCCGAGG + Intergenic
948994373 2:241571080-241571102 GATGGGTGAGGCAGGGGGTGGGG + Intronic
1169038191 20:2470660-2470682 GAGGGCACAGGCTGGCGGCGCGG - Intronic
1169119753 20:3088148-3088170 GAGGAGAGAGGCTGGAGGCCTGG + Intergenic
1170257392 20:14360115-14360137 GGGGGGTGGGGCTGGGGGCTAGG + Intronic
1172155320 20:32820049-32820071 GGGGGGTGCGGCTGGGGGGGCGG + Intronic
1172411809 20:34729926-34729948 GAGAGGTGAGGCTGGAGCTGGGG + Intronic
1172904476 20:38358661-38358683 GAAGGGTGACGCTGGGGGCTGGG - Intronic
1173252916 20:41374081-41374103 ATGGGGAGAGGCTGGGGGCGGGG + Intergenic
1173809534 20:45947729-45947751 GTGGGGTGAGGCTCGCGGCTAGG - Exonic
1174449125 20:50609059-50609081 GTGGGGTGAGGATGGGGGGGAGG + Intronic
1175934643 20:62509321-62509343 AAGGGGTGAGGGTGGAGTCGTGG - Intergenic
1175934667 20:62509395-62509417 AAGGGGTGAGGGTGGAGGGGTGG - Intergenic
1175975502 20:62708611-62708633 GCGGGGCGGGGATGGCGGCGGGG + Intergenic
1176156930 20:63626767-63626789 GCGGCGTCAGGCGGGCGGCGCGG - Intronic
1176194623 20:63831423-63831445 GAGGGGCGGGGCCGGCGGCCGGG - Intergenic
1176382845 21:6121736-6121758 GAGGGGCGTGTCTGGGGGCGGGG + Exonic
1178358781 21:31931398-31931420 GAGGTGAGAGGCTGGAGGTGAGG - Intronic
1178923319 21:36754522-36754544 GAGGGCTGAGGCTCGCTGCAGGG + Intronic
1179149364 21:38796837-38796859 GAGGGAGGAGGCCGGCGGCAGGG - Intergenic
1179452194 21:41474573-41474595 GAGGGGTGAGTGAGGGGGCGAGG + Intronic
1179452224 21:41474647-41474669 GAGGGGTGAGTGAGGGGGCGAGG + Intronic
1179553569 21:42158904-42158926 GGAAGGTGAGGCTGGCGGGGTGG - Intergenic
1179740624 21:43416503-43416525 GAGGGGCGTGTCTGGGGGCGGGG - Exonic
1180093105 21:45542590-45542612 GTGGGGAGAGGCCGGCGCCGGGG - Intronic
1180110083 21:45643473-45643495 CGGGGGTGGGGCTGGGGGCGGGG - Intergenic
1180615138 22:17121411-17121433 AGGGAGGGAGGCTGGCGGCGGGG + Intergenic
1180666728 22:17519176-17519198 GTGGGCTGAGGCTGGTGGTGGGG + Intronic
1180921798 22:19525020-19525042 GGGGGGTGAGGCTGGGGCCCTGG - Intronic
1181051870 22:20241755-20241777 GGGGGGTGAGGCTGCAGGTGAGG + Exonic
1181082782 22:20425537-20425559 GGCGGGCGAGGCTGGCGGCACGG + Exonic
1181085858 22:20439010-20439032 GAAGGGTGGGGCTGGAGGAGGGG + Intronic
1181155761 22:20918956-20918978 GAGGGGTGGGGGTGGGGGTGGGG - Intronic
1182254757 22:29030611-29030633 GAGGGGCGCGGCCGGTGGCGAGG + Intronic
1182693336 22:32178625-32178647 GAGGATTGAGACTGGCAGCGTGG + Intergenic
1183003607 22:34881599-34881621 GAAGGGTGAGGCTGGAGTCAGGG - Intergenic
1183155195 22:36069534-36069556 GAGGGGAGTGGCTGGTGGCTAGG - Intergenic
1183246205 22:36695482-36695504 GAGGGGTGGGGGTGGGGGAGTGG - Intronic
1183272974 22:36873413-36873435 TAGAGGTGAGGCTGGAGGTGAGG + Intronic
1183363376 22:37394489-37394511 GAGAGGTGAGGCTGCCCGGGAGG - Intronic
1183477445 22:38043275-38043297 GAGGGATGGGGCTGGGGGCCTGG - Intergenic
1183517781 22:38277289-38277311 GAAAGGTGAGGCTGGGGGCCTGG - Intergenic
1183744795 22:39686152-39686174 GAGGCCGGGGGCTGGCGGCGGGG - Exonic
1183906227 22:41042498-41042520 GAGGGGGGAGGTTGGGAGCGGGG - Intergenic
1183990518 22:41594380-41594402 GGGGGGTGGGGGTGGGGGCGGGG + Intergenic
1184182929 22:42843176-42843198 GAGGGGTGAGGCATGTGGGGAGG - Intronic
1184263202 22:43331741-43331763 GAGGGGGCAGGCTGGGGGTGAGG - Intronic
1184391775 22:44207236-44207258 GAGGGGTGAGATTGGTGGGGAGG + Exonic
1184391783 22:44207255-44207277 GAGGGCTGGGGCTGGCCGGGAGG + Exonic
1184391800 22:44207293-44207315 GAGGGGTGAGGCTGGCGGGGAGG + Exonic
1184391808 22:44207312-44207334 GAGGGGTGAGGCTGGCGGGGAGG + Exonic
1184391817 22:44207331-44207353 GAGGGGTGGGACTGGTGGGGAGG + Exonic
1184391828 22:44207367-44207389 GGCGGGTGAGGCTGGCGGGGAGG + Exonic
1184391843 22:44207404-44207426 GACGGGTGAGGCTGGCGGGGAGG + Exonic
1184391851 22:44207423-44207445 GAGGGGTGAGGCTGGTGGGGAGG + Exonic
1184391880 22:44207500-44207522 GAGGGGTGAGGCTGGGGAGAAGG + Exonic
1184643905 22:45885894-45885916 GAGGGAGGAGCCTGGTGGCGAGG + Intergenic
1184746409 22:46458636-46458658 GAGGGAAGAGGCTGGAGGCCCGG + Intronic
1184783189 22:46659231-46659253 GAGGGGGGAGGCTGAGGGAGTGG - Intronic
1184806563 22:46798402-46798424 CAGGGGTGAGGCTGGGGCAGAGG + Intronic
1184846254 22:47089576-47089598 GAGGAGTGAGGCCGGCAGGGTGG + Intronic
1184886858 22:47351898-47351920 GAGGAGACAGGCTGGAGGCGGGG - Intergenic
1185118086 22:48949326-48949348 GAGGAGTGAGGCTGGAAGAGAGG - Intergenic
1185118104 22:48949396-48949418 AAGAGGTGAGGCTGGAGGAGGGG - Intergenic
1185336268 22:50272026-50272048 GTGGGGTGGGGGTGGGGGCGGGG + Intergenic
1185369955 22:50456449-50456471 GGGGGGTGAGGGTGGGGGCTCGG - Intronic
1185391070 22:50562140-50562162 GAGGGGTGAGGGGTGAGGCGGGG + Intronic
1185391073 22:50562147-50562169 GAGGGGTGAGGCGGGGTGAGGGG + Intronic
1185391080 22:50562164-50562186 GAGGGGTGAGGCGGGGTGAGGGG + Intronic
1185391112 22:50562265-50562287 GAGGGGTGAGGCGGGGTGAGGGG + Intronic
1185391137 22:50562330-50562352 GAGGGGTGAGGGGTGAGGCGGGG + Intronic
1185391140 22:50562337-50562359 GAGGGGTGAGGCGGGGTGAGGGG + Intronic
1185391165 22:50562402-50562424 GAGGGGTGAGGCGGGGTGAGGGG + Intronic
1185391172 22:50562419-50562441 GAGGGGTGAGGCGGGGTGAGGGG + Intronic
1185391179 22:50562436-50562458 GAGGGGTGAGGGGTGAGGCGGGG + Intronic
1185391209 22:50562513-50562535 GAGGGGTGAGGCGGGATGAGGGG + Intronic
1185391218 22:50562537-50562559 GAGGGGTGAGGCGGGATGAGGGG + Intronic
1185391225 22:50562554-50562576 GAGGGGTGAGGGGTGAGGCGGGG + Intronic
1185391228 22:50562561-50562583 GAGGGGTGAGGCGGGGTGAGGGG + Intronic
1185391235 22:50562578-50562600 GAGGGGTGAGGCGGGGTGAGGGG + Intronic
950102564 3:10367016-10367038 GAGGGCTGAGGCTGCAGGCTGGG - Intronic
950485916 3:13273927-13273949 GGGGAGTGTGCCTGGCGGCGTGG - Intergenic
950509969 3:13420215-13420237 GCGCGGCGAGGATGGCGGCGCGG - Exonic
950640250 3:14344036-14344058 GAGGGGTAAGACTGGAGGCCGGG + Intergenic
950785181 3:15428159-15428181 TAGGGGCGAGGTTGGGGGCGGGG - Intronic
952969282 3:38640827-38640849 TGGGGGTGGGGCTGGGGGCGGGG + Intronic
953620112 3:44525840-44525862 GAGGGGCCAGGCTGGAGCCGTGG - Intergenic
953903236 3:46855006-46855028 GAGGGGTGGGGTGGGGGGCGTGG - Intergenic
954004103 3:47578523-47578545 CAGGGGTCCCGCTGGCGGCGGGG - Intronic
954083205 3:48224457-48224479 ACGGGGTGAGGCTGGGGGCTGGG + Exonic
954677365 3:52323307-52323329 GAGGGAGGAGGCTGGGGGCAGGG + Intronic
955189902 3:56751542-56751564 GAGAGGTGTGGCTGGAGGAGAGG + Intronic
955239354 3:57165422-57165444 GAGGACTGAGGGTGGGGGCGGGG - Intronic
955687466 3:61561753-61561775 GAGGGGAGAGGCAGGGGGAGCGG - Intronic
956420361 3:69080423-69080445 GAGGGGCGGGGCTGGCGAAGCGG + Intergenic
956510243 3:69985460-69985482 GAGGGGTGATGGGGGAGGCGGGG + Intergenic
956963892 3:74435883-74435905 GAGGAGAGAGGCTGCAGGCGGGG - Intronic
957426964 3:80051528-80051550 CAGAGGTGACTCTGGCGGCGGGG - Intergenic
958826300 3:99035206-99035228 GGGCGGTGAGGCTGGGGGAGGGG + Intergenic
960993780 3:123328264-123328286 GAGGGGTGAGGAAGGTGGGGTGG - Intronic
961252537 3:125519700-125519722 GATGGGCGAGGCTGGAGGAGGGG - Intronic
961362556 3:126377229-126377251 TAGGGGTGAGGCTGCTGGGGTGG - Intergenic
961604429 3:128083161-128083183 GGGGAGGCAGGCTGGCGGCGGGG + Intronic
961647794 3:128401631-128401653 GAGGGGTGAGGCTGAGAGAGAGG + Intronic
961809703 3:129514767-129514789 GAGGGCTGAGGCCGGGGCCGGGG - Intronic
961921789 3:130434080-130434102 GAGGGGTGGGGGTTGAGGCGAGG - Intronic
962272348 3:133987147-133987169 GATGGGTGGGGGTGGCGGGGCGG - Intronic
962402493 3:135072573-135072595 CAGGAGTGAGGCTGGTGGTGGGG - Intronic
963732265 3:148985829-148985851 GAGGGGAGAGGCAGGAGGCATGG + Intergenic
964413807 3:156426978-156427000 CAGGGTTGAGGCTGGAGGCAGGG + Intronic
965473891 3:169130461-169130483 GAGGGGGAGGGCTGGCGGCGGGG - Intronic
965757390 3:172040191-172040213 GAGGGGGAGGGCGGGCGGCGAGG + Intronic
966696389 3:182793850-182793872 GCGGGGAAAGGCCGGCGGCGCGG + Intronic
966875194 3:184317493-184317515 GACAGGTGAGGCTGGGGGCTTGG + Exonic
968455990 4:700024-700046 GAGGGGCGAGGCTGGGTGGGGGG + Intergenic
968480382 4:830525-830547 CAGGGGTGTGGCTGGCTGGGTGG + Intergenic
968548307 4:1209859-1209881 GTGGTGTGAGCCTGGCGGCCAGG - Intergenic
968605107 4:1531760-1531782 GAGGCTGGAGGCTGGAGGCGAGG + Intergenic
968654842 4:1773995-1774017 GACAGGTGAGGCTGGGGGCTCGG - Intergenic
968850325 4:3074111-3074133 GGGTGGGGAGGCTGGGGGCGGGG - Intergenic
969302199 4:6303768-6303790 GAGGGGTGAGGTTTGCTGAGGGG - Intergenic
971279826 4:25233986-25234008 GTGGGGCGCGGCCGGCGGCGAGG + Exonic
972396922 4:38664992-38665014 GAGGGGGGCGGCGGGGGGCGCGG - Intronic
973867202 4:55125678-55125700 GAGGGGCGGGGCTGGCCGCACGG - Intergenic
973986365 4:56358235-56358257 GAGGGGTGGGGCTGGTGAGGAGG - Intronic
974055579 4:56979442-56979464 GGGGGGTGGGGGTGGCGGGGGGG + Intronic
974904528 4:68038516-68038538 GCGGGCTGAGGCTGGCGCGGCGG - Intergenic
978173357 4:105701165-105701187 GAGGAGTGAAGCTGGAGGGGAGG - Intronic
978503597 4:109433998-109434020 GAACGGTGAGGCGGGCGGCCCGG + Exonic
980930423 4:139177975-139177997 GGGGCGCGAGGCTGGCGGGGCGG - Intergenic
981259785 4:142706032-142706054 GAGGGATGAGGCTGGGAGTGTGG - Intronic
981536485 4:145805750-145805772 GGGAGGTGAGGCTGGAGGGGAGG - Intronic
983175748 4:164586037-164586059 CAGGAGTGAGGCTGGGGGAGGGG + Intergenic
985565240 5:612216-612238 GAGGGGCGTGGCTGGGGGAGGGG - Intergenic
985672341 5:1213254-1213276 GAGGGGTGGGGATGGGGGCAGGG - Intronic
986386925 5:7243740-7243762 GAGGGGTGAGGCCGTTGGCTGGG + Intergenic
986711786 5:10493095-10493117 GAGGGGAGGGGCTGGAGGCTTGG + Intergenic
987118471 5:14744908-14744930 GAGAGGTCAGGCCGGCGGTGGGG + Intronic
987374095 5:17218048-17218070 GAGGGGTGAGGGGGGCGGCGAGG + Intronic
988680611 5:33480964-33480986 GGGGGGTGAGGATGGAGGGGAGG - Intergenic
989592107 5:43121430-43121452 GAGGGGTGTGGGTAGGGGCGTGG + Intronic
989616437 5:43341189-43341211 CAGCAGTGAGGCTGGCGGGGGGG + Intergenic
990551063 5:56879150-56879172 TAGGTGTGAGGCTTGCTGCGAGG - Intronic
991584205 5:68186167-68186189 GGGCGGTGGGGCTGGCGGCAGGG - Intergenic
991950544 5:71943358-71943380 GAGGGGTGCAGCTGGCTGCATGG + Intergenic
994670336 5:102755394-102755416 CAAGGGTGAGGGTGGGGGCGCGG + Intronic
995151992 5:108859340-108859362 GGGGGGTGAGGCAGGGGTCGGGG - Intronic
996223971 5:120967094-120967116 GAGGGGTGAGTGGGGCGGGGGGG + Intergenic
997522243 5:134530455-134530477 GAGAGGAGAGGCTGGAGGCCAGG + Intronic
997691380 5:135829689-135829711 GAGGGGTGGGGGTGGGGGCAAGG + Intergenic
997852927 5:137348467-137348489 GAGGGGTGGGGGTGGGGGTGCGG + Intronic
997903865 5:137794960-137794982 GTGGGGTGAGGATGTGGGCGGGG + Intergenic
999644889 5:153707844-153707866 GAGGTGTGAGACTGGCTGCTTGG + Intronic
1000970460 5:167708686-167708708 AGGGGGAGAGGCTGGCGGGGAGG - Intronic
1001731593 5:173964465-173964487 GTGGGGTGAGGGTGACGGTGGGG + Intergenic
1001936627 5:175710087-175710109 GAGGGGTGTGGCAGGGGGCCTGG - Intergenic
1001993434 5:176135093-176135115 GGAGGGAGAGGCTGGGGGCGAGG + Intergenic
1002129019 5:177068120-177068142 GATGGGTGAGGCAGGCTGCAGGG - Intronic
1002188348 5:177466417-177466439 CAGGAGTGAGGCAGGCGGCATGG - Intronic
1002293389 5:178214649-178214671 GAGGGCTGGGGCTGGCGGGTGGG - Intronic
1002636515 5:180611535-180611557 GAGGGCTGAGGGTGGGGGCGAGG - Intronic
1002638949 5:180621524-180621546 GCAGGGTGAGGCTGGCCGCGGGG - Exonic
1002741660 5:181438874-181438896 GAGGGGTGAGGCAGGCCATGGGG - Intergenic
1002888798 6:1317044-1317066 GAGGGGGTAGGCTGGGGGGGAGG - Intergenic
1002897764 6:1389455-1389477 GAGGAGTGAGCGCGGCGGCGCGG + Intergenic
1002926530 6:1608925-1608947 GAGGGGTCAGGCTGCGGGCTCGG - Intergenic
1002926968 6:1610403-1610425 GTGGGGGGCGGCGGGCGGCGCGG + Exonic
1003194586 6:3903469-3903491 AAGGAGTGAGGCTGGTGGCAGGG + Intergenic
1004037816 6:11941156-11941178 CAGAAGTGAGGCTGGCGGCATGG - Intergenic
1004054042 6:12116517-12116539 GAGGGGAGAGGCTAGTGGAGGGG - Intronic
1005577812 6:27206189-27206211 GCGGGGTGGGGATGGGGGCGGGG - Intergenic
1006124152 6:31826964-31826986 GAGGGGAGCGGCTGAGGGCGGGG + Intergenic
1006459788 6:34151701-34151723 GTGGGGTGGGGGTGGGGGCGGGG - Intronic
1006750306 6:36372780-36372802 GAGGGGTGGGGCAGGCAGCGTGG + Intronic
1006923955 6:37644053-37644075 GTGGGGTGAGGCAGGATGCGTGG - Intronic
1006923960 6:37644072-37644094 GTGGGGTGAGGCAGGATGCGTGG - Intronic
1006923982 6:37644150-37644172 GTGGGGTGAGGCAGGATGCGTGG - Intronic
1007145255 6:39622959-39622981 GAGAGGTGAGGCTTGGGGTGTGG + Intronic
1007591617 6:43024562-43024584 GAGGAGTGAGGCTGGTGGTTGGG + Intronic
1007717180 6:43864153-43864175 GAAGGGTGAGGCTGCAGGGGAGG - Intergenic
1008161420 6:48080851-48080873 GAGAGCTGAGGCTGGTGGCAGGG - Intergenic
1010029261 6:71256162-71256184 TAGGGGTGGGGCTGGGGGTGGGG + Intergenic
1010175480 6:73023211-73023233 GAGGTGAGAGGCTGGAGGTGAGG + Intronic
1010392068 6:75349345-75349367 GAGGGGTGAGGTTGGGGGCGGGG - Intronic
1011607331 6:89117982-89118004 GAGGGGTGGGGGTCGCGCCGGGG - Exonic
1012624984 6:101393808-101393830 TAGGGGTGAGGTGGGCGGGGAGG - Intergenic
1012824429 6:104128689-104128711 GAGGGGTGAGGCAGGTGAAGGGG + Intergenic
1012887178 6:104859532-104859554 GCGGGGCCAGGCTGGCCGCGGGG - Intronic
1013219352 6:108063678-108063700 GTGGTGTGTGGCAGGCGGCGGGG - Intronic
1013374002 6:109496580-109496602 GAGGGTTGAGGGAGGCGGAGGGG - Intronic
1013448892 6:110259401-110259423 CAGCGGTGAGGCTGGGGGAGGGG + Intronic
1013667976 6:112367188-112367210 GAGGGTGGAGGCTGACGGCTAGG - Intergenic
1014098129 6:117482381-117482403 GAGGGGCGGGTCCGGCGGCGAGG + Intronic
1014632512 6:123803813-123803835 GGGGCGTGAGGCGAGCGGCGCGG + Intergenic
1014870285 6:126586301-126586323 GTGGGGTGAGGGTAGCGGGGAGG + Intergenic
1015315028 6:131807962-131807984 GCGGGGCGGGGCGGGCGGCGCGG + Intergenic
1016714055 6:147203932-147203954 GCGGGGCGAGGCAGGCGGCGCGG + Intergenic
1016863958 6:148747730-148747752 GCGGGGAGAGGGTCGCGGCGGGG + Intronic
1016936260 6:149451153-149451175 GGGGCGTGAGGCTGCAGGCGGGG + Exonic
1017131914 6:151114910-151114932 GAGGAGGGAGGCTGGTGGTGTGG - Intergenic
1017164189 6:151391711-151391733 GAGGGGAGCGGCTGGGGGGGGGG - Intergenic
1018443436 6:163834334-163834356 CTGGAGTGAGGCTGGGGGCGGGG - Intergenic
1018838774 6:167504405-167504427 GAGGGGTGGGGGTGGGGGCTTGG + Intergenic
1018928390 6:168222786-168222808 AAGGGGAGAGGGTGGTGGCGGGG + Intergenic
1019162200 6:170076166-170076188 GAGGGGAGAGCCTGGCAGCCGGG - Intergenic
1019246800 6:170714638-170714660 GAGGGGTGAGGCAGGCCATGGGG - Intergenic
1019277756 7:184785-184807 AATGGGTGAGGCTGGCGAAGAGG + Intergenic
1019365510 7:630609-630631 TACGGGTGAGGCTGGCCCCGGGG + Intronic
1019473515 7:1233318-1233340 GAGGAGTGCGGCTGGGGGCGGGG + Intronic
1019718673 7:2555096-2555118 GGGGGGAGAGGGGGGCGGCGGGG + Intronic
1020139921 7:5606501-5606523 GACGGGGGAGGCTGGCAGCAGGG - Exonic
1020168216 7:5824164-5824186 GGGCCGTGAGGCTGGGGGCGGGG + Intergenic
1020279758 7:6644212-6644234 CAGGGGTGAGGCGGAAGGCGAGG + Intronic
1021360598 7:19708040-19708062 GAGGTGTGGGGCGGGGGGCGCGG - Intronic
1021867078 7:24968682-24968704 GTGGGCTGAGGCTGGCGCCGTGG - Intronic
1022020696 7:26397652-26397674 AGGGGGTGAGGGTGGGGGCGGGG + Intergenic
1022207923 7:28180690-28180712 GCGGGGTGAGGGGAGCGGCGAGG + Exonic
1022776961 7:33536684-33536706 GTGGGGGGAGGCGGGGGGCGGGG - Intronic
1023039043 7:36156162-36156184 TGTTGGTGAGGCTGGCGGCGGGG + Intronic
1023984914 7:45088784-45088806 GAGGGGAGAGGCTGAAGGCAGGG + Intronic
1025697934 7:63789781-63789803 CAGGAGTGAGGCGGGCGGGGCGG - Intergenic
1026617786 7:71921830-71921852 AAGGGGGTAGGATGGCGGCGGGG - Intronic
1027025790 7:74851164-74851186 GAGGTGTGAGGGTGGGGGCGGGG - Intronic
1027051696 7:75025093-75025115 CAGGGCTGGGGCTGGCGGGGTGG + Intergenic
1027061971 7:75092955-75092977 GAGGTGTGAGGGTGGGGGCGGGG + Intronic
1028173567 7:87628289-87628311 GAGGGGCGGGGCCGGCCGCGCGG - Intronic
1028752318 7:94394786-94394808 GAGGGCTGGGGCTGGGGGCCCGG - Exonic
1028773955 7:94657771-94657793 GAGGGGGGATTCTGGCGGCGGGG + Intronic
1029445820 7:100612435-100612457 AAGGGGCGAGGCCAGCGGCGGGG + Intronic
1029448279 7:100626919-100626941 GCGGGCTGGGGCTGGCGGCAGGG + Intronic
1029548344 7:101223043-101223065 GAGGGCAGAGGCTGGTAGCGAGG + Intronic
1029580855 7:101435899-101435921 GAGGGGGGAGGCTGGCGGGCAGG - Intronic
1031011219 7:116526417-116526439 GAGAAGTCAGCCTGGCGGCGGGG - Intronic
1031107917 7:117568384-117568406 GAGCGGTAAGGCTGGTGGCAGGG + Intronic
1032091843 7:128915224-128915246 GAGGGGGGAGGGGGGCGGAGGGG - Intergenic
1032193452 7:129777362-129777384 GAGGGGTGAGGCAGGCGCAGGGG - Intergenic
1033476992 7:141701618-141701640 GAGGGGAGAGGAGGTCGGCGGGG + Intronic
1034885365 7:154794576-154794598 GCTGGGGGAGGCTGTCGGCGGGG - Intronic
1035230549 7:157463525-157463547 GAGGGGTGAGGATGGGGATGGGG - Intergenic
1035291304 7:157840941-157840963 GAGGGGGCAGGCAGGCGGTGAGG - Intronic
1035501342 8:93322-93344 GAGGGGTGAGGCAGGCCATGGGG + Intergenic
1035717187 8:1763623-1763645 GAGGGGCGCGGCGGGGGGCGGGG - Intronic
1036213822 8:6863331-6863353 GAGTGGGGAGGCTGGCGTGGAGG + Intergenic
1036213892 8:6863528-6863550 GGGTGGGGAGGCTGGCGGGGAGG + Intergenic
1037583675 8:20261886-20261908 GAGGGAGGAGGCAGGAGGCGGGG - Intronic
1037605683 8:20435500-20435522 GCTGGGAGAGGCTGCCGGCGGGG - Intergenic
1037952698 8:23029111-23029133 CAGGGGTGAGGCCGGCTGGGTGG + Intronic
1037967648 8:23146431-23146453 CAGGGGTGAGGCCGGCTGGGTGG + Intronic
1037974757 8:23201271-23201293 CAGGGGTGAGGCTGGCTGGGTGG + Intronic
1038021158 8:23552780-23552802 GAGGGGCGAGTCTGGCAGTGGGG + Intronic
1038613022 8:29071447-29071469 CAGGGGTGAGGCTGGGGGCAGGG - Intronic
1038807982 8:30812457-30812479 GAGGGGGGAGGGCGGCGGCCGGG - Exonic
1039502779 8:38030510-38030532 GCGGAGCGAGGCTGGAGGCGCGG + Exonic
1039875155 8:41578505-41578527 GAGCGGAGAGGCGGGCGGCCGGG - Intronic
1040292208 8:46131282-46131304 GAGTGGTGTGGATGGCCGCGAGG - Intergenic
1040951060 8:52939618-52939640 GAGGGGTGGGGGTGGCGCCGCGG - Exonic
1042200362 8:66275164-66275186 AAGGGGTGAGGCTGACAGGGTGG - Intergenic
1043502662 8:80873399-80873421 GAGGGGTGTGTCAGGCGGCGCGG - Intronic
1043791561 8:84474870-84474892 GTGGGGTGGGGCTGGGGGTGGGG - Intronic
1044973767 8:97644299-97644321 GCGGAGTGAGGCTGACAGCGGGG + Exonic
1047338227 8:123956070-123956092 GAAAGGTGAGGCTGGGGGTGGGG + Exonic
1048885282 8:138904470-138904492 GATGGGTGAGGCAGGCTGAGGGG - Intronic
1049166378 8:141128568-141128590 GCGGGGCGGGGCTGGAGGCGGGG - Intronic
1049386399 8:142345046-142345068 GGGGGGTGAGGCTGCCGACCAGG - Intronic
1049476812 8:142800698-142800720 CAGGGCAGAGGCTGGCGGAGAGG + Intergenic
1049540611 8:143207180-143207202 GCTGGGTGAGGCTGGGGGCTAGG + Intergenic
1049635175 8:143684367-143684389 GCGGGGCGAGGCGGGCGGCCTGG + Intergenic
1049784007 8:144441974-144441996 CAGGGGTGAGCCTGGGGGCGGGG - Intronic
1052253415 9:26426523-26426545 GAGGGGTTAAGATGGCGGAGAGG + Intergenic
1052825741 9:33172926-33172948 GAGGGGTAAGGGTGGGGGTGGGG + Intergenic
1053569242 9:39286971-39286993 GAGGGCTGAGGCTGACAGCGGGG + Intronic
1053835196 9:42128004-42128026 GAGGGCTGAGGCTGACAGCAGGG + Intronic
1053835484 9:42130120-42130142 GAGGTGGGAGGCAGGGGGCGGGG + Intergenic
1054090871 9:60845952-60845974 GAGGGCTGAGGCTGACAGCGGGG + Intergenic
1054112282 9:61121509-61121531 GAGGGCTGAGGCTGACAGCGGGG + Intergenic
1054112565 9:61123641-61123663 GAGGCGGGAGGCAGGGGGCGGGG + Intergenic
1054127901 9:61332036-61332058 GAGGGCTGAGGCTGACAGCGGGG - Intergenic
1054595144 9:67058490-67058512 GAGGCGGGAGGCAGGGGGCGGGG - Intergenic
1055930165 9:81551959-81551981 GGGGGGTGAGGCTGGTGCCGAGG + Intergenic
1057182542 9:93037867-93037889 GAGGGCTGGAGCTGGGGGCGGGG - Intergenic
1057195973 9:93115768-93115790 GAGGGGTGAGGGAGGGGGTGAGG + Intergenic
1057196066 9:93116044-93116066 GAGGGGTGAGGGTGGGGGTGAGG + Intergenic
1057620340 9:96629052-96629074 GGGGGGTGAGCCTGGCAGCGGGG - Intergenic
1057794333 9:98144828-98144850 GAGGGGTGAGGCTGAGGGCATGG + Intronic
1057928114 9:99170755-99170777 CAGGGGTGGGGCTGGGGGTGCGG + Intergenic
1058357014 9:104094531-104094553 GAGGCGGGAGGCGGGAGGCGGGG + Intronic
1058923622 9:109640882-109640904 GAGGAGAGCAGCTGGCGGCGCGG - Intronic
1060555315 9:124504830-124504852 GGGGCGCGGGGCTGGCGGCGCGG + Intronic
1060597160 9:124855529-124855551 GTGAGGGGAGGCTGGCGACGAGG + Intronic
1060629455 9:125143140-125143162 GAGGGGTGAGGCTGGCGGCGCGG - Intronic
1060934396 9:127506992-127507014 GAGGGGTGAGGCAGGCGGCGAGG + Exonic
1061127039 9:128683715-128683737 GTGGGATGAGGCTGGGGGAGGGG + Exonic
1061165652 9:128920786-128920808 GAGGGGTTAGGCTGGGTGAGGGG - Intergenic
1061261383 9:129482670-129482692 AGGGGGAGAGGCGGGCGGCGGGG + Intergenic
1061365883 9:130172327-130172349 GAGGGGGGAGGCGGGAGGCGGGG + Intergenic
1061405935 9:130393116-130393138 GACAGGAGAGGCTGGCTGCGTGG - Intronic
1061418761 9:130462076-130462098 CAGGGGTGGGGCTGGCAGCAGGG - Intronic
1061517092 9:131096396-131096418 GAGGGGAGAGGCGGGAGGGGAGG + Intergenic
1061517101 9:131096415-131096437 GAGGGGAGAGGCGGGAGGGGAGG + Intergenic
1061517528 9:131098271-131098293 GCAGGGTGAGGGTGGCGGTGAGG - Intronic
1061594795 9:131621811-131621833 GGGGGGTAGGGCGGGCGGCGGGG + Exonic
1061874105 9:133535372-133535394 GAGGTGGGGGGCAGGCGGCGGGG + Intronic
1061929838 9:133826812-133826834 GAGGGCAGAGGCAGGCGGCCTGG + Intronic
1062230573 9:135479760-135479782 GAGGGGCGGGGCGGGGGGCGGGG - Intronic
1062241909 9:135545499-135545521 GCGGGGTGGGGCAGGCGGCGGGG + Intergenic
1062288964 9:135786145-135786167 GAGGGGTGAGGCTGCCGGGAGGG - Intronic
1062335136 9:136061631-136061653 GAGGGCTGAGGCTGGGGGCTGGG - Intronic
1062352052 9:136144053-136144075 GAGGGGTGAGGTGGGGGGCTGGG - Intergenic
1062364832 9:136203572-136203594 AAGGGGTGAGTGTGGCGCCGAGG + Intronic
1062403662 9:136383368-136383390 GAGGGCTGAGGGAGGCAGCGGGG + Exonic
1062405362 9:136393690-136393712 GAGGGGTGTGGCTCGGGGCGCGG - Intronic
1062439872 9:136564931-136564953 GAGAGGTGAGGCTGGGAGCTGGG - Intergenic
1062472043 9:136710399-136710421 GAGGGGTGGGCCTGGGGGTGTGG - Intergenic
1062500413 9:136849676-136849698 CAGGGGCGGGGCTGGCGGGGCGG + Intronic
1062541038 9:137041625-137041647 CAGGGGTGGGGCTGGTGGCAGGG + Intronic
1062582533 9:137234853-137234875 CAGGGCTGAGGCTGGCGGCCAGG - Intronic
1185575984 X:1172639-1172661 GAAGGCTGATGCTGGTGGCGAGG + Intergenic
1186496264 X:10014962-10014984 GAGGGGTGGGGGTGGGGTCGAGG + Intergenic
1186901990 X:14066385-14066407 GGGGGGGGGGGCGGGCGGCGGGG - Intergenic
1187048858 X:15675969-15675991 GGAGTGGGAGGCTGGCGGCGGGG + Intergenic
1187149594 X:16669419-16669441 GGGGGGTGGGGGTGGCGGTGAGG + Intronic
1187770462 X:22690261-22690283 GTGGGGTGAGGGTGTCAGCGAGG + Intergenic
1187871282 X:23767080-23767102 CAGGAGAGAGGCTGGCGGCGTGG - Intergenic
1189303401 X:39969284-39969306 GCTGGGGGAGGCTGGCGGCTTGG - Intergenic
1189319789 X:40080784-40080806 GAGGGTTGAGGCTAGCAGAGCGG + Intronic
1189328041 X:40125007-40125029 GAGGGGTGTGTGTGGCGTCGGGG + Intronic
1190791068 X:53700900-53700922 GAGGGGTGTGCATGGGGGCGGGG - Intergenic
1192139557 X:68636063-68636085 GAGGGTGGAGGCTGGAGGCAGGG + Intergenic
1192143374 X:68663558-68663580 GATGGGTTAGGCTGGTGGAGTGG + Intronic
1192436133 X:71145008-71145030 GAGGGGTTAGGATGGGGGCAAGG - Intronic
1192498602 X:71633553-71633575 GACTGCTGAGGCTGGAGGCGAGG + Intergenic
1192553688 X:72073250-72073272 TAAGGGTGAGGGTGGGGGCGGGG + Intergenic
1192577545 X:72255064-72255086 GAGGAGTCGGGGTGGCGGCGAGG + Intronic
1193360608 X:80574656-80574678 GAGCCGGGAGGCGGGCGGCGCGG + Intergenic
1193375173 X:80751710-80751732 GAAGGGTGAGGCTGTGGGAGGGG - Intronic
1195108655 X:101623917-101623939 GAGGGACGGGGGTGGCGGCGGGG + Intronic
1195215103 X:102691587-102691609 CAGCGGTGAGGCTGGGGGAGGGG - Intergenic
1195378437 X:104249816-104249838 GAGGGGTGAGGATGGGGTGGGGG + Intergenic
1195922103 X:109994162-109994184 GAGGGGTGTGAGTGGCGGGGAGG - Intergenic
1197279507 X:124518411-124518433 GAGGGGTGGGGCGGGCAGGGAGG + Intronic
1198254823 X:134915345-134915367 AAGAGGTGGGGCTGGGGGCGGGG + Intergenic
1199607232 X:149586561-149586583 GGGGGGTGAGGATGGAGGTGGGG + Intronic
1199631891 X:149782806-149782828 GGGGGGTGAGGATGGAGGTGGGG - Intronic
1199872778 X:151913387-151913409 GAGGGGTGAGGTCGGTGGAGGGG - Intronic
1199873111 X:151914675-151914697 GAGGGGTGAGGTTGGTGGAGGGG - Intronic
1199873139 X:151914760-151914782 GAGGGGTGAGGTCGGTGGAGGGG - Intronic
1199873288 X:151915355-151915377 GAGGGGTGAGGTTGGTGGAGGGG - Intronic
1199873638 X:151916719-151916741 GAGGGGTGAGGTTGGTGGAGGGG - Intronic
1199873666 X:151916804-151916826 GAGGGGTGAGGTCGGTGGAGGGG - Intronic
1199873815 X:151917399-151917421 GAGGGGTGAGGTTGGTGGAGGGG - Intronic
1199873993 X:151918074-151918096 GAGGGGTGAGGTTGGTGGAGGGG - Intronic
1199874350 X:151919437-151919459 GAGAGGTGAGGTTGGTGGAGGGG - Intronic
1201393100 Y:13520012-13520034 CAGAGGTGAGGCTGGGGGAGGGG - Intergenic
1202378658 Y:24258900-24258922 GACAGGAGAGCCTGGCGGCGGGG + Intergenic
1202492124 Y:25411221-25411243 GACAGGAGAGCCTGGCGGCGGGG - Intergenic