ID: 1060634409

View in Genome Browser
Species Human (GRCh38)
Location 9:125189153-125189175
Sequence CTGAGGAAGGGGAAGGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 639}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060634409_1060634421 17 Left 1060634409 9:125189153-125189175 CCCACCGCCTTCCCCTTCCTCAG 0: 1
1: 0
2: 4
3: 54
4: 639
Right 1060634421 9:125189193-125189215 GGCCGCGTTCCGGTAGCCGGTGG No data
1060634409_1060634419 7 Left 1060634409 9:125189153-125189175 CCCACCGCCTTCCCCTTCCTCAG 0: 1
1: 0
2: 4
3: 54
4: 639
Right 1060634419 9:125189183-125189205 AACACACTGAGGCCGCGTTCCGG No data
1060634409_1060634420 14 Left 1060634409 9:125189153-125189175 CCCACCGCCTTCCCCTTCCTCAG 0: 1
1: 0
2: 4
3: 54
4: 639
Right 1060634420 9:125189190-125189212 TGAGGCCGCGTTCCGGTAGCCGG No data
1060634409_1060634417 -4 Left 1060634409 9:125189153-125189175 CCCACCGCCTTCCCCTTCCTCAG 0: 1
1: 0
2: 4
3: 54
4: 639
Right 1060634417 9:125189172-125189194 TCAGAGACCTAAACACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060634409 Original CRISPR CTGAGGAAGGGGAAGGCGGT GGG (reversed) Intronic
901057504 1:6455478-6455500 CTGAGGCAGCGGCAGGCGGTGGG + Intronic
901144091 1:7053612-7053634 GGGAGGAAGGGGAAGGGGATGGG - Intronic
901196901 1:7445370-7445392 GTGAGGAAGGGGAAGCCCATGGG + Intronic
901252877 1:7795111-7795133 CTGAGAAAGGGCACAGCGGTGGG + Intronic
901858542 1:12059595-12059617 GTGAGGAAGGTGAATGCAGTAGG - Intergenic
902387311 1:16083303-16083325 CTGAGGAAGGGGCTGGCAGGGGG - Intergenic
902476857 1:16693000-16693022 CTGAGGCAGCGGCAGGCAGTGGG - Intergenic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903304237 1:22401465-22401487 CGGAGGAGTGGGAAGGCAGTGGG - Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903750686 1:25618406-25618428 CTGAGGCAAGGGAAAGGGGTGGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904013506 1:27403747-27403769 CTGAGGAAGGCGAGGGGGCTGGG - Intergenic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904426040 1:30423779-30423801 CAGAGGATGAGGAAGGCAGTGGG + Intergenic
904756682 1:32771942-32771964 CTGAGGAGGGGGCAGGCACTGGG - Exonic
904896692 1:33823157-33823179 CTGAGGAAAGGGGAGGCGGTAGG - Intronic
904937028 1:34138411-34138433 CTCAGGGAGGTGAAGGAGGTTGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905277161 1:36825681-36825703 TTGAGGAAGGAGAAGACGCTGGG + Exonic
905489366 1:38331680-38331702 CTGAGGAGGAGGAAGGCAGGTGG - Intergenic
906182418 1:43833706-43833728 GGCAGAAAGGGGAAGGCGGTAGG + Intronic
906326281 1:44848111-44848133 CTGAGGAAGGGGGAGGCCCATGG - Intergenic
908316509 1:62937794-62937816 CTGAGGAAAGGGCAGGCAGCCGG + Intergenic
908524596 1:64975822-64975844 CCGAGGAAGTGGATGGCGCTAGG - Intergenic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911253224 1:95604133-95604155 CTGAGGAGCAGGATGGCGGTGGG + Intergenic
911595410 1:99793755-99793777 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
911653306 1:100414220-100414242 CTTTGGAAGGCCAAGGCGGTAGG + Intronic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
911884309 1:103278327-103278349 CTGAGGCAGGGGAATCCGGGAGG - Intergenic
912966300 1:114240122-114240144 CTGGGGAAGGGGGTGGCTGTGGG + Intergenic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
913567329 1:120085550-120085572 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
913630805 1:120707996-120708018 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
913665979 1:121049225-121049247 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
913975082 1:143449632-143449654 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
914017377 1:143832501-143832523 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914069474 1:144275248-144275270 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
914109681 1:144691106-144691128 CTGACGCAGGGGAAGCCGGCCGG - Intergenic
914288077 1:146246256-146246278 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914549113 1:148697002-148697024 CTGAGAAAGAGAAAGGCTGTTGG - Intergenic
914617569 1:149374717-149374739 CTGAGAAAGAGAAAGGCTGTTGG + Intergenic
914655988 1:149741033-149741055 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914713741 1:150237292-150237314 CTTTGGAAGGCCAAGGCGGTTGG + Intergenic
914825021 1:151133643-151133665 CTGAGGATGGTGGAGGCTGTAGG - Intronic
915128259 1:153680272-153680294 AGGAGGAAGGGGGAGGCGGAAGG - Intronic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915339186 1:155167043-155167065 CTGAGGGAGAGAGAGGCGGTAGG - Intergenic
915528522 1:156490407-156490429 CCGAGGGAGGGAAAGACGGTGGG - Intronic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915972324 1:160363373-160363395 TTGAGGGAGGGGAGGGAGGTTGG - Intergenic
916415951 1:164592093-164592115 CAGATGAAGGGGATGGGGGTTGG + Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
917113017 1:171571330-171571352 CTTAGGGAGGGGAAGGGTGTTGG - Exonic
917143276 1:171859278-171859300 ATGAGGAAGTGGGAGGCAGTTGG - Intronic
917759460 1:178140954-178140976 CTCAGGAAGCGGAAGGCAGAAGG + Intronic
917980417 1:180265756-180265778 CATAGGAAGGGGATGGAGGTAGG + Intronic
918078068 1:181185489-181185511 GTGAGGAAGGGGATGGGAGTTGG + Intergenic
918626024 1:186656683-186656705 CTGAGCAAGGTGAATGCAGTTGG - Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919708672 1:200704511-200704533 CTGAGGAAGGGGAAGACATAAGG - Intergenic
919775390 1:201190992-201191014 CGCAGGAAGGGGCAGGCAGTGGG + Intronic
919804956 1:201376008-201376030 CTGATGCAGGGGAAAGAGGTGGG + Intronic
920336159 1:205246830-205246852 CTGAGCAGGGGGAAGACGTTGGG + Intronic
920688929 1:208131086-208131108 CTGAGGGAGGGGAAAGGTGTTGG - Intronic
920799589 1:209173998-209174020 CTGAAAAAGGGGCAGGCAGTAGG + Intergenic
921051211 1:211513074-211513096 CTGAGGAAAGAGGAGGCTGTTGG + Intergenic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
922068286 1:222165905-222165927 CTGAAGAAGGAGAAAGCAGTAGG + Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922724848 1:227918055-227918077 CTGAGGAAGAGGAGGACCGTTGG - Intergenic
922860829 1:228814939-228814961 CTCAGAAAGGGGAGGGCGGGAGG - Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923570042 1:235105265-235105287 CTGTGGGAGAGGAAGGCTGTGGG + Intergenic
924630513 1:245735420-245735442 CTGTGGAAGGCCAAGGCGGGTGG + Intergenic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
924953609 1:248907114-248907136 CTCAGCAAGAGGAATGCGGTAGG + Intronic
1062784894 10:256190-256212 GTGAGGCAGGGGAAGGTGATGGG - Intergenic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1063334238 10:5195852-5195874 CTTTGGAAGGCCAAGGCGGTAGG - Intronic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063482333 10:6386631-6386653 GTGAGGAAGGGGAAGGCCCAGGG - Intergenic
1063593202 10:7411301-7411323 AGGAGGAAGGGGAGCGCGGTGGG - Intronic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1064013598 10:11755787-11755809 CAGAGGAACAGGCAGGCGGTCGG - Intronic
1064840757 10:19588884-19588906 CTTTGGAAGGCCAAGGCGGTCGG - Intronic
1066370562 10:34815321-34815343 CTGGGGGAGGGGACGGCGGGAGG + Exonic
1067143144 10:43673032-43673054 CAGAGGAAGAGGTAGGTGGTTGG - Intergenic
1069483518 10:68805530-68805552 CTTTGGAAGGCCAAGGCGGTAGG + Intergenic
1069498715 10:68930359-68930381 CTTTGGAAGGGCAAGGCGGGTGG - Intronic
1069595764 10:69669048-69669070 CTGAGGCTGGGGATGGGGGTGGG + Intergenic
1069757601 10:70782705-70782727 CTCAGGAAGGGGAGGGGTGTGGG - Intronic
1069781248 10:70957107-70957129 CTGAGAAGGGGGCAGGGGGTGGG - Intergenic
1069862132 10:71478385-71478407 CTGAGGAAGGGGAGGGCACTAGG - Intronic
1069993469 10:72328903-72328925 CTGAGGAGGTGGCAGGAGGTTGG + Intergenic
1070317221 10:75325965-75325987 CTGAGGGAGGCCAAGGCGGGAGG - Intergenic
1070360171 10:75680664-75680686 ACGAGGAAGGGGAAGTAGGTAGG + Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1071175729 10:82924427-82924449 ATGAGGAAGGGGTAGGAAGTTGG + Intronic
1072578351 10:96720137-96720159 CTGAAGAAGTGGGAGGGGGTCGG + Intronic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1073150114 10:101305704-101305726 CTGAGGAAGGGGACGGGAGGGGG - Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074618285 10:115092815-115092837 CGGAGGAAGGGGGAAGCGCTAGG + Intergenic
1074813600 10:117127968-117127990 CTGAGGAAGGGGAACGTGATTGG - Intergenic
1074853122 10:117454550-117454572 CTGGGGAAGGGGATGGCTGTGGG + Intergenic
1075079326 10:119372146-119372168 CTGAGCTAGGGGATGGAGGTAGG + Intronic
1076822800 10:132948764-132948786 CTTATCAAGGGGAAGGAGGTAGG - Intergenic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078391430 11:10938607-10938629 AAGAGGAAGGGGAAGGAGATGGG - Intergenic
1079098446 11:17526270-17526292 GTGAGGAAGGGGAGGGCAATAGG + Intronic
1079776497 11:24536959-24536981 CTGAGGAAGAGGAAGGCCCAAGG + Intronic
1079839851 11:25382884-25382906 CACTGGAAGGGGAAGGCTGTGGG + Intergenic
1080572045 11:33565521-33565543 CTCAGGAAGGGGAAGCCAGGAGG + Intronic
1081622832 11:44629055-44629077 CTGAGGGAGGAGAAGGAGTTAGG - Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1081845324 11:46237314-46237336 ATGAGTAAGAGGAAGCCGGTAGG + Intergenic
1081994032 11:47352306-47352328 CTGTGGAAGGTGAAGGCAATGGG + Intronic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082850686 11:57761773-57761795 CTTAGGAAAGCGAAGGGGGTAGG + Intronic
1082893439 11:58164366-58164388 GTGGGGATGGGGCAGGCGGTGGG + Intronic
1083145112 11:60752357-60752379 CTGAGGAAGGGAAAGACCGATGG + Intergenic
1083208643 11:61168698-61168720 CTGATGCAGGGGAAGGAGATGGG - Intergenic
1083243174 11:61404604-61404626 TGGAGGAAAGGGAAGGGGGTGGG + Exonic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1083692092 11:64415519-64415541 CTGAGGAGAGGGGAGGAGGTGGG + Intergenic
1083722043 11:64607974-64607996 GTGAGGAAGGGGTAGAAGGTAGG + Exonic
1084148060 11:67275471-67275493 AGGAAGAAGGGGAAGGGGGTGGG - Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085800680 11:79586275-79586297 CTGAGGAAGTGCAAGGGGTTGGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087267372 11:96075647-96075669 CTGAGCTAGGGGAAGTCGGGTGG + Intronic
1088644178 11:111903296-111903318 CTTTGGAAGGGCAAGGCGGGTGG + Intergenic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089700618 11:120241794-120241816 CTGTGGAAGTGGGAGGGGGTGGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1091583236 12:1801159-1801181 CTGAGGCAGGGGCAGGGGGTGGG - Intronic
1091768475 12:3137057-3137079 CTGAGGCAGGGGACTGCGGCCGG + Intronic
1091828670 12:3534048-3534070 GGGAAGAAGGTGAAGGCGGTGGG + Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092822383 12:12364721-12364743 CTTTGGAAGGCCAAGGCGGTTGG + Intronic
1095450959 12:42329977-42329999 CTCAGCAAGGGGAATGCGGCAGG + Intronic
1095930978 12:47624699-47624721 CTGGGGAAAGGGATGGCTGTGGG + Intergenic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096695663 12:53346507-53346529 CTGGGGTAGAGGAAGGCTGTGGG + Intergenic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1096977794 12:55709290-55709312 CACAGGAAGAGGAAGGAGGTAGG - Intronic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099640606 12:85279757-85279779 CTCAGGAAGGCGCAGGCAGTAGG + Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100383002 12:94079168-94079190 CTGATGAAGAGGAATGGGGTGGG + Intergenic
1100982179 12:100170536-100170558 CAGGGGATGGGGCAGGCGGTTGG + Intergenic
1101276678 12:103209736-103209758 ATGAGGAAGAGCAAGGCGGAGGG - Intergenic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102269103 12:111515859-111515881 ATAAGGAGGGGGAAGGCTGTGGG + Intronic
1102582181 12:113896659-113896681 GTGAGGAGAGGGAAGGCGGGAGG + Intronic
1102600342 12:114025024-114025046 CTTATGAAGGGGAAAGGGGTGGG - Intergenic
1103611032 12:122124297-122124319 CTGAGGAGGGGGACGGCTGAGGG - Intronic
1103611046 12:122124331-122124353 CTGAGGAGGGGGACGGCTGAGGG - Intronic
1103923833 12:124413063-124413085 CCGAGGGAGGGGAAGCCTGTGGG - Intronic
1104307226 12:127620477-127620499 ATGAGGAGTGGGAAGCCGGTGGG + Intergenic
1104548272 12:129732152-129732174 CTGAGGAAGGGCAAGTGGCTGGG - Intronic
1104622973 12:130332167-130332189 CTGGGGGAGGGGAACGGGGTTGG - Intergenic
1104916690 12:132269184-132269206 CTGAGGCAGGGGGAGGCGTCGGG + Intronic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106946656 13:34835296-34835318 CTGAGGATGGGGAAAGGTGTTGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1113337155 13:109387699-109387721 CTGTGGAGTGGGAAGGCAGTGGG - Intergenic
1114006602 14:18320253-18320275 CTCAGCAAGAGGAATGCGGTAGG - Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114535160 14:23417940-23417962 CTGTGGCAGGGAAAGGCAGTGGG - Intronic
1115983329 14:39077645-39077667 GTGAGGAAGGGGAAGTAGATTGG - Intronic
1116798116 14:49413418-49413440 CTTAGAAAGAGGAAGGCAGTGGG + Intergenic
1117340497 14:54787781-54787803 CTGAGGAAGGATAAGGCTGGTGG - Intronic
1118312300 14:64703228-64703250 CGGAGGAAGCGGTAGGCGCTCGG - Intergenic
1118620427 14:67609785-67609807 GAGAAGAAGGGGAAGGGGGTGGG + Intergenic
1118764671 14:68901857-68901879 GGGAGGAAGGGAGAGGCGGTGGG - Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121456698 14:94043095-94043117 GTGAGGAGGGAGAAGGTGGTGGG - Intronic
1121882926 14:97516482-97516504 CTGAGGAGGGGGAGGGTTGTGGG - Intergenic
1122119511 14:99544565-99544587 CTGAGGCAGGGGATGGGGCTTGG + Intronic
1122203296 14:100135684-100135706 CTGGGGAAGGGGAAGGCTACAGG - Intronic
1122267112 14:100551862-100551884 GTGGGGAAGGGGAAGTGGGTCGG + Intronic
1122828516 14:104383913-104383935 TTGAGGACGGGGCAGGCAGTGGG - Intergenic
1122874333 14:104656602-104656624 CTGAGGACGTGGAGGGCGGTGGG + Intergenic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1124252635 15:28117038-28117060 GTGAGGAAGGAGGAGGCTGTCGG + Exonic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125850061 15:42894506-42894528 CTGTGGGAGGCGAAGGCGGGTGG + Intronic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128073703 15:64813014-64813036 CTGCGGAAGGGGAAGGGGCTGGG + Intergenic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128349854 15:66881510-66881532 GTGGGGCAGGGGAAGGCGGGTGG + Intergenic
1128801785 15:70501685-70501707 CTGATCAAGGGGAAGGGGTTGGG + Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129218887 15:74119543-74119565 GTGAGGAAGGGTAAGGGGGAGGG - Intronic
1129232376 15:74203897-74203919 CTCAGGATGGGGATGGGGGTGGG + Intronic
1129288765 15:74547153-74547175 CGGGGGAGGGGGAAGGCGGGGGG - Intronic
1130090539 15:80817166-80817188 CTGGGGATGCGGAAGGCTGTGGG + Intronic
1131621438 15:94072295-94072317 ATGAGGAAGTGGAAGGTGTTGGG - Intergenic
1131793278 15:95988044-95988066 CTGAGGAAGGCCATGGCGCTGGG - Intergenic
1132066111 15:98732558-98732580 GTGAGCATGGGGAAGGGGGTCGG + Intronic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134897065 16:17897778-17897800 CTAAGGAAGGGGAATCAGGTGGG - Intergenic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135775372 16:25253382-25253404 CTGGGGAAGGGAAAGGGGGTAGG - Intronic
1136000040 16:27285569-27285591 CTGTGGAAGGCCAAGGCGGGAGG + Intronic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137476844 16:48816815-48816837 CTGAGGAAGGGGTTGTGGGTGGG + Intergenic
1137617530 16:49856334-49856356 CTGAGGAGGGGGAACGGGGCTGG + Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1138710762 16:58967941-58967963 TTGAGGATGGGGAAGAGGGTGGG - Intergenic
1139060940 16:63250684-63250706 AAGAAGAAGGGGAAGGCGGAGGG + Intergenic
1139356728 16:66371265-66371287 CTGTGGAATGGGAAAGCGGTGGG + Intronic
1139394294 16:66627926-66627948 CTCAGCAAGAGGAATGCGGTAGG + Intronic
1139632017 16:68236644-68236666 CTGGGAAAGGGGAGGGCGGCGGG + Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139884096 16:70196675-70196697 GCCAGGAAGGGGAAGGCGTTTGG + Intergenic
1139895976 16:70288403-70288425 ATCAAGAAGGGGAAGGCGGCCGG - Intronic
1139920364 16:70455937-70455959 CTTAGGAAGGCCAAGGCGGGAGG + Intronic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140368422 16:74398821-74398843 GCCAGGAAGGGGAAGGCGTTTGG - Intergenic
1140655147 16:77132382-77132404 AAGAGGAAGGGGAAGGGGATGGG - Intergenic
1141088078 16:81110804-81110826 GTGAGGATGGGGAAGGCCCTGGG + Intergenic
1141416479 16:83879384-83879406 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142845222 17:2669500-2669522 CTTAGGAAGGCCAAGGCGGGCGG - Intronic
1142968353 17:3594914-3594936 CTGAAGAACGGGAAGTCAGTGGG + Intronic
1143181852 17:4988269-4988291 CAGAGGATGGGAAAGGCAGTTGG + Exonic
1143470813 17:7174068-7174090 CTGAGGAGAGAGAAGGCGGGTGG + Intronic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143615290 17:8045936-8045958 CTTAGGAAGGGGAAGGACCTGGG + Intronic
1143749336 17:9016984-9017006 CTGAGGATGGGGGAGGAGCTGGG - Intergenic
1144070196 17:11664591-11664613 CTGAGGAAGGAGGATGGGGTTGG - Intronic
1144339165 17:14298360-14298382 CTGCGGAATGGGAAGACGGTTGG + Intergenic
1144568733 17:16381354-16381376 CTGAGGGGGGCGAGGGCGGTTGG + Intronic
1144571270 17:16400907-16400929 CTCAGCAAGAGGAATGCGGTAGG - Intergenic
1144619651 17:16809324-16809346 CTGAGCATGAGGAAGGCAGTTGG - Intergenic
1144893034 17:18506380-18506402 CTGAGCATGAGGAAGGCAGTTGG + Intergenic
1145139183 17:20437912-20437934 CTGAGCATGAGGAAGGCAGTTGG - Intergenic
1146188638 17:30745756-30745778 CTGAGGCAGGAGAATGCGGGAGG - Intergenic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147752508 17:42744923-42744945 CTGAGGGAGGGAGAGGCGGAGGG - Intronic
1147870377 17:43582934-43582956 CTGAGAAGGGTGACGGCGGTTGG - Intergenic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148747966 17:49928964-49928986 GTGTGGAGGGGGAAGGCTGTGGG - Intergenic
1148757290 17:49980199-49980221 CTCAGGAAGGGGAAAGGAGTCGG + Intergenic
1148759936 17:49994409-49994431 GAGAGGAAGGGGAAGGCTGTGGG - Intronic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149691170 17:58578121-58578143 CTAAGGAATGGGATGGGGGTGGG - Intronic
1150457336 17:65317372-65317394 ATGAGGAAGGGGAAGGGGCTTGG + Intergenic
1150767772 17:68015762-68015784 CTAAAGGAGGGGAAGGAGGTGGG + Intergenic
1151520106 17:74622237-74622259 CTGAGGATGGGGAATGAGATAGG + Intronic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151645851 17:75431138-75431160 CTGAGGCAGGAGAATGCGGGAGG - Intergenic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152083563 17:78203778-78203800 CTTTGGAAGGGCAAGGCGGACGG + Intronic
1152161836 17:78673664-78673686 CAGAAGCAGGGGAAGGCGCTTGG - Intergenic
1152227385 17:79098741-79098763 CTGAGGAGGGGTAAGGGGCTGGG - Intronic
1152368919 17:79873019-79873041 ATTAGGAAGAGGAAGGAGGTCGG - Intergenic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1153679657 18:7488579-7488601 CTGAGGAATGGGAGGGCGCATGG - Intergenic
1154130789 18:11735292-11735314 CTTTGGAAGGGCAAGGCGGGTGG - Intronic
1156736140 18:40262218-40262240 CTGAGGCAGGGGAACCCGGGAGG + Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1160774440 19:848544-848566 TTGAGGAAGGGGATGGGGATGGG + Intergenic
1160785379 19:897932-897954 ATGGGGAAGGGGAGGCCGGTGGG - Intronic
1160859281 19:1230878-1230900 CTGGGTAAGGGTAGGGCGGTGGG - Exonic
1161629343 19:5344463-5344485 CAGAGGGCGGGGAAGGGGGTAGG - Intergenic
1161698194 19:5782015-5782037 CTGGGGAAGGGGTAGGCTGAAGG + Intergenic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162016859 19:7850877-7850899 CTGAGGCCGGAGAAGGCGTTAGG - Intronic
1162054172 19:8052949-8052971 CTGAGGAAGAGGAGGGGAGTGGG - Intronic
1162205900 19:9055801-9055823 CTGGGGATGGGGAAGCCGGGAGG - Intergenic
1162330747 19:10027747-10027769 CCCAGGGAGGGGAAGGCGGGCGG + Intergenic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1163019192 19:14473585-14473607 CTGAGGCCGGGGGAGGCCGTCGG + Exonic
1164479800 19:28602612-28602634 CTGAGGAGTGGGAGGGAGGTGGG - Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166198076 19:41219522-41219544 CTGGGGCAGGGGTAGGAGGTGGG + Intronic
1166213684 19:41322730-41322752 ATGGGGATGGGGCAGGCGGTGGG - Exonic
1166287073 19:41837778-41837800 AGGAGGAAGGGGAAGGCGCCTGG - Intronic
1166993576 19:46707851-46707873 CTGTGGGAGGGCAAGGCGGGTGG + Intronic
1167144344 19:47672947-47672969 CCAAGGAAGGGGAGGGTGGTGGG - Intronic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167465852 19:49650944-49650966 CAGAGGAGGGGGCAGGGGGTGGG - Exonic
1167499649 19:49837881-49837903 CTGTGGATGGGGAAGACGGTGGG + Intronic
1167521639 19:49959152-49959174 CTGAGGTGGGGGAAGTGGGTGGG + Intronic
1167523742 19:49971570-49971592 CTGAGGTGGGGGAAGTGGGTGGG - Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167756322 19:51415690-51415712 CTGAGGTGGGGGAAGTGGGTGGG + Intronic
1167763157 19:51462023-51462045 CTGTGGGAGGGAAAGGCTGTGGG - Intergenic
1168253549 19:55154933-55154955 CTGAGGGAGGAGAAGGGGCTGGG + Intronic
1168260240 19:55189469-55189491 GTGAGGAAGGGGAGGGCAGTGGG - Intronic
1202710872 1_KI270714v1_random:18826-18848 CTGAGGCAGCGGCAGGCAGTGGG - Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925948909 2:8893051-8893073 CAGAGGCAGGGGGAGGGGGTGGG + Intronic
926135189 2:10331309-10331331 GTGAGGAAGGAGAGGGCGCTCGG - Intronic
926367463 2:12146235-12146257 CTGAGGAGGGGGTCGGTGGTGGG - Intergenic
926429102 2:12767703-12767725 CTGAGGAAGATGGAGGTGGTAGG - Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927561451 2:24076822-24076844 CTGAGGAGGGTGGTGGCGGTGGG + Intronic
927692743 2:25219683-25219705 CTAAGGCAGGGGAAGGCTGAGGG + Intergenic
927788923 2:25994534-25994556 CTTAGGAAGGCCAAGGCGGGTGG - Intergenic
927932334 2:27053050-27053072 ATGGGGAAGGGGTAGGAGGTGGG + Exonic
928186406 2:29115218-29115240 CTGAGGGCTGTGAAGGCGGTGGG + Intronic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
929668814 2:43853470-43853492 CTGAGGAAGGGCATGGCTGCTGG + Intronic
929831700 2:45352113-45352135 ATGAGGCAAGGGAAGGCGGGAGG + Intergenic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
930385966 2:50695178-50695200 CTGGGTAAGGGGGTGGCGGTGGG + Intronic
931702806 2:64922846-64922868 TTGCGGGAGGGGAAGGCTGTTGG - Intergenic
931762856 2:65432270-65432292 TTTGGGAAGGGGACGGCGGTGGG + Intronic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932002242 2:67895667-67895689 CAGAGGAAGGGGTTGGGGGTTGG - Intergenic
932219223 2:69987147-69987169 CTGAGTGAGGGGAAGGCATTGGG + Intergenic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933949905 2:87319976-87319998 CAGAGGAAGAGGCAGGCTGTGGG + Intergenic
934123819 2:88866698-88866720 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
934179784 2:89610605-89610627 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
934290076 2:91684866-91684888 CTGACGCAGGGGAAGCCGGCCGG + Intergenic
935032511 2:99336397-99336419 CAGAGGAAGGGGCGGGCGGTCGG + Exonic
936061954 2:109300673-109300695 AGGAGGAAGAGGAAGGTGGTTGG - Intronic
936164133 2:110105359-110105381 ATGAGGAAAGGGAAGGCCTTGGG - Intronic
936330287 2:111541621-111541643 CAGAGGAAGAGGCAGGCTGTGGG - Intergenic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
937132465 2:119523893-119523915 CAGAGGAAGGGGTCGGTGGTGGG + Intronic
937146291 2:119647928-119647950 GTGATGAAGGGGTAGGCTGTGGG + Intronic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
938949548 2:136244107-136244129 CTGAGGAAGAGAGAGGCGGCTGG + Intergenic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
939177326 2:138764180-138764202 CTCAGGAAGGGGAATGCCTTAGG - Intronic
939799917 2:146696643-146696665 CTTAGGAAGGCCAAGGCAGTAGG + Intergenic
941080463 2:161054913-161054935 CTGAGGAAAGGGGAGGTGATGGG + Intergenic
941408650 2:165124936-165124958 CTGAAGCAGGGGAAGGCAATTGG - Intronic
941845341 2:170126449-170126471 CTGGGGAAAGGGGAGGCTGTGGG + Intergenic
941923735 2:170875706-170875728 CTGAGGAGGGTAAAGGAGGTTGG - Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942452193 2:176115258-176115280 GTAAGGGAGGGGAAGGAGGTGGG - Intronic
943408709 2:187519741-187519763 CTGGGGAAAGGGGAGGCTGTGGG - Intronic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
943920334 2:193699156-193699178 CTGAGAAACTGGAAGGAGGTGGG - Intergenic
944069184 2:195650948-195650970 GTGGGGAAGGCGAAGGAGGTGGG + Intronic
944811790 2:203334182-203334204 CTGTGGAAGGCCAAGGCGGGTGG - Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946204780 2:218096306-218096328 CTCAGCAAGAGGAATGCGGTAGG - Intergenic
946273830 2:218615806-218615828 CTCAGGGAAGGGAAGGAGGTTGG + Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
947379991 2:229536193-229536215 CTGAGGAAGGCTGAGGAGGTTGG + Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
949044014 2:241862373-241862395 GTGAGGAAGGAGCAGGCGGTGGG - Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169074228 20:2751677-2751699 CTGGGGAAGGGGGCGGCGTTTGG - Intronic
1169189182 20:3646517-3646539 CAGATGGAGGGGAAGGCGGAGGG + Intronic
1169356696 20:4912827-4912849 TTGTGGGAGGGGATGGCGGTGGG + Intronic
1169471027 20:5885781-5885803 CTCAGCAAGAGGAATGCGGTAGG - Intergenic
1169601818 20:7269701-7269723 AGGAGGAAGGGGAGGGCGTTTGG - Intergenic
1171204409 20:23267687-23267709 CTGAGGAAGGGGCTGGGGCTAGG + Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172699397 20:36843609-36843631 CTCAGGAAGTGCAAGCCGGTAGG + Intronic
1173105792 20:40132841-40132863 TTGAGGCAGGGCAAGGCGATGGG - Intergenic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173955028 20:47024982-47025004 CTGAGGAAGAGGAAGAAGATAGG - Intronic
1173984711 20:47252048-47252070 CTGTGGAAGGCCAAGGCGGGAGG + Intronic
1174412759 20:50346552-50346574 TTGAGCAAGGGTAAGGAGGTGGG - Intergenic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1175057560 20:56211981-56212003 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1175830888 20:61965183-61965205 CTGAGGTCCGGGAAGGCGGGGGG + Intronic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1177463163 21:21439360-21439382 CTGAGGGAGGCTAAGGCGATTGG - Intronic
1178480328 21:32974644-32974666 TTGGGGAAGGGGAAGGCTGAAGG + Intergenic
1179453750 21:41483884-41483906 CTTTGGAAGGGCAAGGCGGGAGG + Intronic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1180431111 22:15251064-15251086 CTCAGCAAGAGGAATGCGGTAGG - Intergenic
1181528211 22:23502050-23502072 CAGAGGAAAGGGCAGGTGGTGGG - Intergenic
1181535215 22:23538509-23538531 CTCAGCAAGGGGAATGCGGTGGG - Intergenic
1181860969 22:25817953-25817975 GTGAGGAAGGGAAATGGGGTAGG + Intronic
1182102982 22:27670728-27670750 CTCAGGAGGGGGAAGGGGGAAGG - Intergenic
1183080682 22:35454176-35454198 GTGGTGAAGGGGAAGGCGTTGGG - Intergenic
1183253066 22:36743986-36744008 AAGAGGAAGGGGAAGGGGTTTGG - Intergenic
1183349188 22:37325151-37325173 TTAAGGAGGGGGACGGCGGTGGG + Intergenic
1183427632 22:37747905-37747927 CTGAGCAAGGGTAAGGCTGCCGG + Intronic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1184523297 22:45008074-45008096 CTAGGGAAGTGGAAGGTGGTGGG + Intronic
1185015056 22:48338348-48338370 ATGAGGATGGGGGAGGCCGTGGG + Intergenic
949414104 3:3798704-3798726 CCGAGGAAGGGGAGGAGGGTGGG - Intronic
950040406 3:9916156-9916178 CTGAAGGAGGGTGAGGCGGTGGG + Exonic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
950652932 3:14418929-14418951 CGGGGGAAGGGGAAGGGGCTGGG - Intronic
951174108 3:19579000-19579022 CTGGGGAAGAGGAAGTCAGTAGG + Intergenic
952331238 3:32366230-32366252 ATGGGGAAGGGGAAGAGGGTTGG - Intronic
954111783 3:48437650-48437672 TTGAGGAAGGGGCAGTTGGTAGG - Intronic
954140713 3:48603776-48603798 CAGAGACAGGGGAAGGGGGTTGG - Intronic
954604792 3:51900937-51900959 TAGAGGAAGGTGCAGGCGGTGGG - Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
956833621 3:73077478-73077500 CTGAGGAAGGGGAATTTGATAGG - Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957741665 3:84278663-84278685 TGGAGGAAGGGGAAGAGGGTAGG + Intergenic
960616929 3:119604603-119604625 CTGAGAAGGGGGAAGGAGTTGGG + Intronic
961071772 3:123936686-123936708 AGGAGGGAGGGGAAGGTGGTAGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961714199 3:128847575-128847597 GGGAGGAAGGGGAAGGGGGCAGG + Intergenic
961786280 3:129348985-129349007 CTGAGAAAGGGGAAGTGAGTAGG + Intergenic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962345677 3:134617727-134617749 CAAAGGAAGGGGAAGGTTGTGGG + Intronic
962610373 3:137071168-137071190 GTGAGGAAGGAGAAGGCATTGGG - Intergenic
963248287 3:143082907-143082929 CTGAGGTGGGGGAAGGGGGGTGG - Intergenic
964277926 3:155027476-155027498 CTGAGGGCAGGGAAGGTGGTTGG - Intronic
964365757 3:155949430-155949452 GGGAGGAAGGGGATGGTGGTGGG + Intergenic
965466944 3:169041403-169041425 CTGTGGAAGGCCAAGGCGGGTGG - Intergenic
965478246 3:169184590-169184612 CTGAGGAAGAGGTAGGAGCTAGG + Intronic
965768186 3:172153525-172153547 CTGAGGAAGGAGCAGGCTGGGGG + Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967185759 3:186943243-186943265 TTGAGGCAGGGGAAGGCTGCAGG + Intronic
967328295 3:188264566-188264588 ATGAGGTAGGGGAGGGAGGTGGG + Intronic
967370877 3:188744700-188744722 CTGAAGAGGGGAAAGGAGGTTGG - Intronic
967930735 3:194688243-194688265 GGGAGGTAGGGGAAAGCGGTCGG - Exonic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
969148092 4:5141811-5141833 CTGAGGAAGGTGGAGGGGGTGGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969692171 4:8709788-8709810 GTGTGGAAGGGGAGGGCTGTGGG - Intergenic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
969829494 4:9783017-9783039 CTGACGCAGGGGAAGCCGGCCGG - Exonic
970092555 4:12426887-12426909 AAGAGGAAGGTGCAGGCGGTGGG + Intergenic
970254654 4:14154859-14154881 GTGAGGAAGGGGAATACAGTAGG - Intergenic
970600109 4:17635218-17635240 GGGAGGAAGGGGAAGTCAGTGGG + Intronic
971405572 4:26319295-26319317 CGGAGGAAGGGGAAGCCAGGAGG - Intronic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
972896267 4:43624806-43624828 TGGGGGAAGGGGAAGGGGGTTGG - Intergenic
973602899 4:52559636-52559658 TTGAGGAAGGGGAAGGGAGGTGG + Intergenic
974586303 4:63883084-63883106 GTGAGGAAGGGGATGGGGGGTGG - Intergenic
974621187 4:64356652-64356674 CTCAGCAAGAGGAATGCGGTAGG - Intronic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975519646 4:75286796-75286818 CTCAGCAAGAGGAATGCGGTAGG + Intergenic
975734980 4:77372347-77372369 CGGAGGTAGGGGAAGGGAGTGGG + Intronic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976579766 4:86721988-86722010 CTTTGGGAGGTGAAGGCGGTTGG - Intronic
976715989 4:88122708-88122730 CTGAGGTAAGGGGAGGCTGTGGG + Intronic
976948398 4:90798855-90798877 CTGAGGTGGGGGGAGGCAGTGGG + Intronic
977603511 4:98959060-98959082 CTGAGGAAGGAGAACTCGGGAGG - Intergenic
978847545 4:113292111-113292133 CTTAAGAAGGTGAAGGGGGTGGG - Intronic
979618960 4:122776448-122776470 CTGAGGAACTGGGAGGAGGTGGG + Intergenic
981333311 4:143538081-143538103 CTAAAGAAGTGGAAGGCAGTCGG + Intronic
981990060 4:150907338-150907360 GGGAGGAAGGGGAAGGGGGAGGG + Intronic
982102734 4:151984075-151984097 CTGGGGAAAGGGAAGGCCATTGG - Intergenic
982352245 4:154428655-154428677 CTTTGGAAGGGCAAGGCGGGTGG + Intronic
982745451 4:159101511-159101533 CAGAGGATGGGGAAGGCTGTGGG + Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983648082 4:170011989-170012011 CAGAGGAGGGGGAAGTAGGTTGG + Intronic
983904314 4:173168758-173168780 CGGAGGAGGGGGAAGGAGGGAGG + Exonic
985218518 4:187678009-187678031 CTGGGGAAGGTCAAGGCCGTAGG - Intergenic
985665684 5:1180605-1180627 CTGAGGCGGGGGATGGGGGTGGG + Intergenic
985744155 5:1637110-1637132 CTGACGCAGGGGCAGGAGGTGGG - Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
986504396 5:8433630-8433652 CTATGGAAGGGGAAGGATGTGGG - Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988483099 5:31645937-31645959 CTCAGTAGGGGGAAGGGGGTGGG + Intronic
989163325 5:38412041-38412063 CTTTGGAAGGCGAAGGCGGGCGG - Intronic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
992212747 5:74496750-74496772 CTGAGGCAGGGCATGGGGGTGGG - Intergenic
994534107 5:101006390-101006412 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
994843472 5:104954918-104954940 CTTTGGAAGGCCAAGGCGGTAGG - Intergenic
995225131 5:109692297-109692319 CTGCTGGAGGGGAAGGCTGTTGG + Intronic
997361045 5:133295116-133295138 CTGAGGAGGGAGAAGAAGGTCGG - Intronic
997380824 5:133436333-133436355 CTGGGTAAGGGGGAGGCAGTGGG + Intronic
997507578 5:134430205-134430227 CAGAGGGAGGGGAAAGAGGTGGG + Intergenic
997980919 5:138466947-138466969 CTGAGGACGAGGAGGCCGGTGGG - Exonic
998583809 5:143405031-143405053 CTGAGAAAGGAGAGGGCCGTGGG + Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
1000379302 5:160614669-160614691 CTGAGGAGGGAGAATGGGGTTGG - Intronic
1001084523 5:168691033-168691055 CTGAGGAAGGAAAAGGCTGCTGG - Intronic
1001403663 5:171461193-171461215 GTGGGGAAGGGGAGGGCAGTGGG + Intergenic
1002077823 5:176719638-176719660 CTGAGGGAAGGGATGGTGGTGGG - Intergenic
1002268750 5:178055521-178055543 CTCAGCAAGAGGAATGCGGTAGG + Intronic
1002302192 5:178263403-178263425 CTGGGGAAGGGGATGGCGTGGGG - Intronic
1002400497 5:178989190-178989212 GTGGGGAGGGGGAAGGCGGGAGG - Intronic
1003261017 6:4516157-4516179 CTGCGGGTGGGGGAGGCGGTGGG + Intergenic
1005399240 6:25414760-25414782 ATGTGGAAGGGGATGGGGGTTGG - Intronic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1005763175 6:28986344-28986366 CTGAGGAATGGGGTGGGGGTAGG - Intergenic
1006132982 6:31879840-31879862 CTGAGGATGGGGAACACGGGGGG + Exonic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006480398 6:34288448-34288470 CCAAGGCAGGGGAAGGCTGTTGG + Exonic
1006630836 6:35428436-35428458 CTGGGGAAGGGGAAGGCCCCTGG + Intergenic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006706165 6:36023303-36023325 CTTTGGAAGGCCAAGGCGGTTGG + Intronic
1007175186 6:39891518-39891540 AAGAGGAAGGGGATGGAGGTGGG + Intronic
1007719210 6:43875480-43875502 ATGGGGAAGGGGATGGCTGTGGG + Intergenic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1010463284 6:76138041-76138063 GTGAGGTAGGGGAAGGGGGGAGG - Intergenic
1010668264 6:78655424-78655446 CTGAGGGAAGGGATGGCTGTGGG - Intergenic
1011677666 6:89750844-89750866 CTGTGGGAGGCCAAGGCGGTCGG - Intronic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013817514 6:114116672-114116694 AAGAGGATGGGGAAGGAGGTGGG - Intronic
1014207230 6:118669437-118669459 GTAAGGAAGGGCAAGGGGGTGGG - Intronic
1015394730 6:132721004-132721026 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1015430732 6:133128023-133128045 CTGAGGAAGGGGAGAGCACTAGG + Intergenic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017841170 6:158224188-158224210 CTGAGGCAGGGGAGGGCTGGAGG - Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018799849 6:167213563-167213585 GTGTGGAAAGGGAAGGCAGTGGG + Intergenic
1018813158 6:167312324-167312346 GTGTGGAAAGGGAAGGCAGTGGG - Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1019341079 7:509234-509256 CAGATGAAGGGGACGGCGTTAGG + Intronic
1019472653 7:1229696-1229718 CGGGGGAAGGGGCAGGCGGAAGG + Intergenic
1019498641 7:1353126-1353148 CAGTGGGTGGGGAAGGCGGTGGG - Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1019960870 7:4458342-4458364 CTGCGGGAGGGCAAGGCAGTAGG + Intergenic
1020130212 7:5555322-5555344 GTGAGGGAGGGGAACACGGTGGG - Intronic
1021308633 7:19063484-19063506 TTGAGGAGGTGGAAGGAGGTGGG - Intronic
1021610591 7:22454237-22454259 CTGAGGCAGGGGTTGGAGGTGGG - Intronic
1022357677 7:29631058-29631080 CTCAGCAAGGGAGAGGCGGTGGG + Intergenic
1022367996 7:29744016-29744038 CTCAGCAAGGGAGAGGCGGTGGG + Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1023343570 7:39248418-39248440 CTGAGGAGGGGAAAGGCGATGGG - Intronic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023626675 7:42121720-42121742 CTGATGGAGGGGGAGGAGGTGGG - Intronic
1023842182 7:44104084-44104106 CTGAGGGAAGGAAAGGTGGTGGG - Intergenic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024471717 7:49773610-49773632 CTGCGGCAGGGGGAGGCGGGAGG + Intergenic
1024673764 7:51620031-51620053 CTCAGGCTGGGAAAGGCGGTGGG - Intergenic
1025298470 7:57796259-57796281 CTTTGGAAGGTCAAGGCGGTTGG + Intergenic
1025797932 7:64757388-64757410 CTGTGGAAGGGGACGGCAGCAGG + Intergenic
1026212660 7:68319553-68319575 ATGAGGAAGGGGCAGGCTGCTGG - Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1029676647 7:102074433-102074455 TTCAGGAAGGGGAAGCAGGTGGG - Intronic
1029790615 7:102839286-102839308 CTCAGCAAGAGGAATGCGGTAGG - Intronic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1030880543 7:114873067-114873089 CAGTGGAAAGGGAAGGCAGTTGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032296124 7:130639964-130639986 CTGAGAAAAGGGACGGCTGTTGG - Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1033589515 7:142797630-142797652 CTGGGGAAGAGGGAGGGGGTGGG + Intergenic
1034289037 7:149913387-149913409 CTGAGGATAGGGGAGGCGGGTGG + Intergenic
1034439050 7:151077287-151077309 GTGAGCAAGGGGCAGGCGGCAGG - Intronic
1034452617 7:151145303-151145325 GTGAGGAAAGGGGAGGAGGTAGG + Intergenic
1034662034 7:152779462-152779484 CTGAGGATAGGGGAGGCGGGTGG - Intronic
1035047215 7:155975557-155975579 CTGAGGAGGGGTGAGGAGGTGGG + Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035665418 8:1376574-1376596 CTGAAGAAGGGGGAGCCGGGTGG + Intergenic
1036662168 8:10715607-10715629 CTGAGGAAGAGGGCGGCGGCTGG - Intergenic
1037121604 8:15294327-15294349 CTAATGAAGGAAAAGGCGGTAGG - Intergenic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038158279 8:25011889-25011911 CTGAGGGACGGGAAGGTAGTTGG - Intergenic
1038460165 8:27709526-27709548 CTGAGGCAGGGGGAGGCGCTTGG + Intergenic
1038736572 8:30174994-30175016 CTGAGGATGGGTGAGGCTGTTGG - Intronic
1039022549 8:33223639-33223661 CTGAGGCAGGCGGAGGGGGTGGG + Intergenic
1039674545 8:39647181-39647203 CTCAGCAAGAGGAATGCGGTAGG + Intronic
1039801835 8:40964563-40964585 CTGAGGGAGGGGGTGGCTGTGGG + Intergenic
1040509304 8:48079713-48079735 GGGAGGAAGGGGAAGACGCTTGG + Intergenic
1041116160 8:54539614-54539636 TGGAGGAAGGGGAAAGCTGTGGG - Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041629546 8:60070913-60070935 CTGAGGTAGTGGAAGCAGGTAGG - Intergenic
1042076280 8:64998501-64998523 CTGAGGAAGAGGAATTTGGTGGG - Intergenic
1042216868 8:66436522-66436544 ATGGGGATGGGGAAGGCTGTGGG + Intronic
1042281477 8:67061344-67061366 CTTTGGAAGGCGAAGGCGGGAGG + Intronic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1045115222 8:98973816-98973838 CTGAGGGAGGGGGAGGCCGCCGG - Intergenic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047311160 8:123693281-123693303 TTGAGGCAGGGGAAGGCCGCTGG - Exonic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048262595 8:132957652-132957674 CTTAGGAAGGGGCAGGCGTGGGG + Intronic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048317912 8:133375552-133375574 CTGGAGAAGGGGAGGGCAGTGGG + Intergenic
1048445735 8:134491702-134491724 ATGGGGAAGAGGAAGGCAGTAGG - Intronic
1048902140 8:139049084-139049106 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1048902343 8:139050902-139050924 CTCAGCAAGGGGAATGCGGCAGG - Intergenic
1049002203 8:139833279-139833301 CTAAGGAAGGGGAAGTCGGCTGG - Intronic
1049852952 8:144843955-144843977 CTGAGGAAGGGGATAGGGCTGGG - Intronic
1050068449 9:1785819-1785841 CTGAGAAGGGGGAAGACAGTGGG - Intergenic
1051238127 9:15023468-15023490 CTGAGGATGGGGGTGGGGGTTGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1051990151 9:23143200-23143222 CAGAGGCAGGGCAAGGCTGTTGG + Intergenic
1052981001 9:34449258-34449280 CTGGGGAAGGTCAAGGCTGTAGG + Intronic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1053231746 9:36416184-36416206 CGGAGGGAGGGGGAGGGGGTGGG + Intronic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053393277 9:37751441-37751463 CTGGGGAAGGGCAAGGCTGTGGG + Intronic
1053708570 9:40781691-40781713 CTCAGCAAGAGGAATGCGGTAGG + Intergenic
1054418481 9:64902486-64902508 CTCAGCAAGAGGAATGCGGTAGG + Intergenic
1055452755 9:76445634-76445656 CTGAGGGAGGCCAAGGCGGGAGG - Intronic
1057012413 9:91616890-91616912 CTCAGAAAGGGGAAGGAAGTTGG + Intronic
1057220134 9:93253101-93253123 ATGGGGATGGGGAAGGGGGTGGG - Intronic
1057491216 9:95521353-95521375 CTGAGGAGTAGGAAGGCAGTTGG + Intergenic
1058479361 9:105375281-105375303 CTTTGGGAGGCGAAGGCGGTTGG - Intronic
1058828385 9:108794672-108794694 CTGAGGACGGTGAAGACGATTGG - Intergenic
1060274145 9:122169594-122169616 CTGAGGAAGCTGAAGGCTTTTGG - Intronic
1060309679 9:122448127-122448149 CTCAGCAAGGGGAATGCGGCAGG + Intergenic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060967669 9:127720871-127720893 GGGAGGAAGGGGAAGGGGGAGGG - Intronic
1061001118 9:127903631-127903653 CTCAGGAAGCGGATGGAGGTGGG - Intronic
1061012831 9:127965563-127965585 CTGAGGGAGGGGCAGACGGATGG - Intronic
1061255876 9:129454032-129454054 CAGAGGAAAGGGCAGGTGGTTGG + Intergenic
1061284865 9:129616457-129616479 CTTAGGAAGGCGAAGGGGGGTGG - Intronic
1061306609 9:129736231-129736253 CTTGGGAAGTGGAGGGCGGTGGG - Intergenic
1061670348 9:132184993-132185015 CTTAAGAAGGGGAAGGCGCTGGG + Intronic
1061759446 9:132840059-132840081 CTGTGGAAGGCCAAGGCGGGTGG - Intronic
1061854912 9:133436791-133436813 CAGAGGAGGGGGATGGCGGTGGG - Intronic
1061883477 9:133579281-133579303 CTGAAGGAGGTGGAGGCGGTGGG + Exonic
1062286374 9:135774838-135774860 GTGTGGAAGGGGGTGGCGGTGGG - Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1185785902 X:2890648-2890670 TTTAGGAAGGGGAGGGCGGGGGG + Intergenic
1186589428 X:10914323-10914345 CTTAGGGAGGCGAAGGCGGGCGG - Intergenic
1187403176 X:18980631-18980653 CTCAGCAAGGGGAATGCGGCAGG - Intronic
1187913208 X:24129484-24129506 CTGAGGAAGGGGAGGGGTGCTGG + Intergenic
1187972623 X:24674054-24674076 AAGTGGAAGGGGAAGCCGGTTGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188471287 X:30542528-30542550 CTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1189052993 X:37665988-37666010 CTGAGGTAGGAGAATGCTGTAGG + Intronic
1189385229 X:40531553-40531575 TGGAGGAAGGGGAAGGGGGTTGG + Intergenic
1190210641 X:48443921-48443943 CTGGGGAAGGGAAAGGCAGAGGG + Intergenic
1190330402 X:49231830-49231852 CTGTGGAAGGTGAAAGCAGTGGG - Exonic
1190781297 X:53598472-53598494 CTGAGGAGGAGGAAGGAAGTGGG - Intronic
1191090624 X:56616718-56616740 ATGAGGGAGGGGCAGGCTGTAGG + Intergenic
1192262136 X:69511748-69511770 GTGAGGAAAGGGAAGACAGTGGG + Intronic
1192423190 X:71052314-71052336 CTTTGGAAGGCCAAGGCGGTTGG + Intergenic
1193635811 X:83948091-83948113 TGGAGGTAGGGGAAGGCTGTGGG + Intergenic
1194315239 X:92369111-92369133 CTGAGGGAAGGGGAGGCTGTGGG - Intronic
1195111610 X:101656554-101656576 CTGAGGAAGGGGAGTCCGGGTGG - Exonic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1196520653 X:116667517-116667539 CTACGGAAGGGGAAGGCGCCTGG + Intergenic
1197512323 X:127385573-127385595 CTTTGGAAGGCCAAGGCGGTTGG - Intergenic
1198278145 X:135116949-135116971 CTCGGGACGGGGAAGGGGGTGGG - Intergenic
1198292817 X:135255567-135255589 CTCGGGACGGGGAAGGGGGTGGG + Intronic
1198479364 X:137026985-137027007 GTGAGGCAGGTGAAGGCAGTGGG + Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200129150 X:153831496-153831518 CTGAGGAACAGGTAGGCGGCGGG - Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200259837 X:154608251-154608273 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1200266791 X:154650489-154650511 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1200623290 Y:5480646-5480668 CTGAGGGAAGGGGAGGCTGTGGG - Intronic