ID: 1060639267

View in Genome Browser
Species Human (GRCh38)
Location 9:125225095-125225117
Sequence AATAATAAGACTGGGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060639262_1060639267 -8 Left 1060639262 9:125225080-125225102 CCCATCTCTAAAAATAATAATAA 0: 30
1: 290
2: 1184
3: 5495
4: 32580
Right 1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG No data
1060639259_1060639267 16 Left 1060639259 9:125225056-125225078 CCAGCCTGGACAACATAGCAAGA 0: 644
1: 8499
2: 45142
3: 126102
4: 245246
Right 1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG No data
1060639258_1060639267 21 Left 1060639258 9:125225051-125225073 CCAGTCCAGCCTGGACAACATAG 0: 2
1: 88
2: 1280
3: 6687
4: 8839
Right 1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG No data
1060639261_1060639267 -7 Left 1060639261 9:125225079-125225101 CCCCATCTCTAAAAATAATAATA 0: 23
1: 205
2: 793
3: 5322
4: 29221
Right 1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG No data
1060639260_1060639267 12 Left 1060639260 9:125225060-125225082 CCTGGACAACATAGCAAGACCCC 0: 237
1: 3300
2: 13803
3: 56808
4: 139847
Right 1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG No data
1060639263_1060639267 -9 Left 1060639263 9:125225081-125225103 CCATCTCTAAAAATAATAATAAG 0: 2
1: 41
2: 1460
3: 3996
4: 19744
Right 1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060639267 Original CRISPR AATAATAAGACTGGGTGTGG TGG Intronic
No off target data available for this crispr