ID: 1060643861

View in Genome Browser
Species Human (GRCh38)
Location 9:125261775-125261797
Sequence GCGCGCGTGCGCAGCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060643861_1060643870 22 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643870 9:125261820-125261842 CAGGACGCAGGGAAGCCAACAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1060643861_1060643868 11 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643868 9:125261809-125261831 CAGCGCCGCTGCAGGACGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122
1060643861_1060643866 3 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643866 9:125261801-125261823 CGTGGCGGCAGCGCCGCTGCAGG 0: 1
1: 0
2: 1
3: 20
4: 192
1060643861_1060643867 10 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643867 9:125261808-125261830 GCAGCGCCGCTGCAGGACGCAGG 0: 1
1: 0
2: 2
3: 13
4: 146
1060643861_1060643871 29 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643871 9:125261827-125261849 CAGGGAAGCCAACAGGCGAGTGG 0: 1
1: 0
2: 1
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060643861 Original CRISPR GCGCGCGTGCGCAGCGCCGC GGG (reversed) Intronic
903044167 1:20553340-20553362 CCGTGCGAGCGCAGCGCCGCCGG + Exonic
906637213 1:47417320-47417342 GCGCTCGAGGGCGGCGCCGCAGG - Exonic
908501211 1:64745212-64745234 GCGGGCCTGGGCAGCGCGGCGGG + Exonic
910936496 1:92486959-92486981 CCGCGCGGGGGCAGCGCCGGCGG + Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
916749885 1:167714334-167714356 GGGCGCGGGCGGGGCGCCGCCGG + Intergenic
919748652 1:201023565-201023587 GCGCGCGGGCCCAGCCCCGGGGG - Exonic
919748675 1:201023651-201023673 GTGCGCGTGTGCCGCGCCGTAGG - Exonic
921089519 1:211830278-211830300 GCCCGCTCGCGCAGCGCCTCGGG - Intronic
921384073 1:214551822-214551844 GCGCGCGCCCGCGGCGCCCCCGG - Intronic
921781730 1:219173772-219173794 GCGCGCATGCGCAGCGCTGCTGG - Intergenic
922748273 1:228059356-228059378 ACGCGCGAGCGGAGCGGCGCCGG + Exonic
1064712323 10:18140421-18140443 GAGAGCGGGCGCAGCGCGGCGGG - Intergenic
1070768135 10:79068131-79068153 GCCCGCGCGCACAGCGCCCCGGG + Intergenic
1072188438 10:93062689-93062711 GCGCGCGTGATCAGCGCTGGCGG - Intronic
1073251072 10:102120593-102120615 ACGTGCGTGCGCCGCGCGGCGGG + Intergenic
1073503841 10:103967036-103967058 GCGCGCGTGCGCGGGGCCAGAGG + Intergenic
1077049646 11:560957-560979 GCCCGGGTGCGCCGCGGCGCTGG + Intronic
1077101540 11:824713-824735 GCGCGCATGCGCAGAGCTTCGGG - Exonic
1077367887 11:2168499-2168521 GAGGACGTGCGCAGCCCCGCGGG - Exonic
1083617984 11:64035844-64035866 GCTCGCGCGGGCACCGCCGCTGG + Intronic
1090385505 11:126355753-126355775 TCGCGCCAGCGCTGCGCCGCCGG + Intronic
1091273149 11:134331985-134332007 GCGCGCGGGAGCCTCGCCGCGGG - Exonic
1092521796 12:9283643-9283665 GTGCGCATGCGCAGCGGCGGGGG + Intergenic
1092545488 12:9448213-9448235 GTGCGCATGCGCAGCGGCGGGGG - Intergenic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094025716 12:25958573-25958595 GCGCGCGAGAGGAGCGGCGCGGG - Intergenic
1094507465 12:31073838-31073860 GTGCGCATGCGCAGCGGCGGGGG + Intronic
1094838145 12:34331833-34331855 GTGCACGTGCGCAGGGCCGAGGG + Intergenic
1095440873 12:42238033-42238055 GAGCACGGGGGCAGCGCCGCTGG - Intronic
1096682800 12:53268176-53268198 GCGGGAGCGCGCAGCGCGGCGGG + Intergenic
1102884101 12:116508676-116508698 GCGCGCCTGAGCAGCGGCCCTGG - Intergenic
1106269218 13:28138185-28138207 GCGCGCACGCGCAGCGGCGACGG + Intergenic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1113779726 13:112969180-112969202 GGGGGCGCGCGCTGCGCCGCGGG - Intronic
1113948982 13:114060724-114060746 GCGGGCGAGCGCAGCGCTGGGGG - Intronic
1115851794 14:37595163-37595185 GCGGGCGGGGGCAGCGCCGGGGG + Intronic
1117119708 14:52553622-52553644 GGGCGGGTGCGCGGGGCCGCCGG + Intronic
1123890459 15:24773237-24773259 GCGCGCCTGCGCGGCTCCGGTGG + Intergenic
1123901151 15:24878420-24878442 GCGCGCCTGCACAGCGCAGGCGG + Intronic
1125674168 15:41493807-41493829 GCGCGGGCGTGCAGCGGCGCAGG + Intronic
1127083987 15:55408018-55408040 GCGCGAGTGCACAGCTCCGGAGG - Intronic
1128153650 15:65378178-65378200 GGGCGCGTCCGCCGCGCAGCCGG - Intergenic
1128161099 15:65423118-65423140 GCGCGCGGGCGCAGGGTCCCCGG - Intergenic
1129710714 15:77819169-77819191 GGCCGCGCGCGCCGCGCCGCCGG + Intronic
1129814553 15:78540416-78540438 CCGCGCATGCGCAGAACCGCTGG - Exonic
1129933793 15:79432618-79432640 GCGCGTGTGCACCGAGCCGCGGG - Intronic
1131257359 15:90871490-90871512 GCCCGCGTTCCCAGCGCCGTGGG - Intronic
1131466125 15:92655899-92655921 GCGGGCGAGCGGAGCGCAGCCGG - Exonic
1132314262 15:100879296-100879318 GGGCACGTGCGCAGCGACGCGGG + Intronic
1133021636 16:2969484-2969506 TCGCGCGTGCGCAGCGCCGGAGG + Exonic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1138327941 16:56191244-56191266 GCGCGTGTGCGCGCCGCCGCCGG + Intergenic
1139952205 16:70677944-70677966 GCCCGCCTGCCCAGCGCCCCTGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143510977 17:7394787-7394809 GCGTGCGTGCTCAGCGCCCTGGG + Exonic
1143599043 17:7932090-7932112 CCGCGCGTGCGCGGCTCCGGTGG - Intronic
1144021023 17:11240583-11240605 GCGAGCGAGCGGAGAGCCGCCGG - Intergenic
1144787472 17:17840106-17840128 GCGCGCGTGCGGAGCCGCCCCGG - Intergenic
1147765538 17:42833352-42833374 GCGCACGTGCACAGCCTCGCAGG + Intronic
1148818347 17:50346380-50346402 GCGTGCGTGCGGGGCGCCGGCGG + Intronic
1151755735 17:76074469-76074491 CTGCGTGTGCGCCGCGCCGCAGG - Intronic
1152245607 17:79183215-79183237 GCGCACGTGCGCCGGGCCGGGGG + Intronic
1152581187 17:81166236-81166258 GAGCGCGCGCGGAGCGGCGCGGG + Intergenic
1152751802 17:82065726-82065748 GCGGGCGTTCGCGGCGCCCCGGG - Intronic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1160204503 18:76822283-76822305 GGGCGCATGCGCGGCGCCGCGGG - Exonic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160894259 19:1395320-1395342 GACCGCGTGCACAGCGCAGCCGG - Intronic
1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG + Intergenic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1162954269 19:14089839-14089861 GAGCGCTTGCGCTGCCCCGCGGG - Exonic
1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG + Exonic
1163159727 19:15457474-15457496 GCCGGCGGGCGCAGCGCTGCGGG - Exonic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1165867896 19:38950108-38950130 GCCCGCGACCGCAGCGCCGAGGG - Exonic
1166042824 19:40213680-40213702 GCGCCAGGTCGCAGCGCCGCCGG - Exonic
1167071906 19:47226691-47226713 TCGCCCGTGCCCAGCGCCCCGGG - Exonic
1168561671 19:57389829-57389851 GCGTGCGTGCGCACCGTCGGAGG + Intronic
1168641395 19:58034084-58034106 GCGAGCGCGCCCAACGCCGCGGG - Exonic
924987692 2:287357-287379 GCGCGCGTGAGCTGCGGCGCGGG - Intronic
927472241 2:23385314-23385336 GCGCCCGTCCGCAGCCCCGGCGG + Exonic
928549418 2:32356946-32356968 TCGCGCGTGCCACGCGCCGCGGG - Intergenic
930177416 2:48314866-48314888 GCGCCCGGGAGCTGCGCCGCGGG - Intronic
932257789 2:70302028-70302050 GCGCCGGCGCGGAGCGCCGCGGG - Exonic
936433243 2:112482180-112482202 GCGCCCGGGCGCGGCGCCGCCGG + Exonic
938402639 2:131005696-131005718 GCGGGAGTGCCCAGCGCCCCAGG + Intronic
944221859 2:197310942-197310964 GGGCGCGGGGGCAGCGCCGGGGG - Intronic
945319615 2:208406695-208406717 GAGCGCGAGCGCAGCCGCGCGGG + Intronic
1170924799 20:20712743-20712765 GTGCGCGTGCGTAGCGCCCAAGG - Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1181270787 22:21657497-21657519 GCGCGCGTGCCCAGAGCAACGGG + Intronic
1181670553 22:24423882-24423904 GCGCCCGTGAGCGGCGCGGCCGG + Intronic
1181831609 22:25564784-25564806 GCGCGCGTGCGCGGGGCGCCGGG + Intergenic
1182435393 22:30326656-30326678 GGGCGCGTGAGTAGCGCCGGGGG - Exonic
1183368677 22:37420188-37420210 GCGCGCGCTCGGAGCCCCGCCGG - Intronic
1183788408 22:40045217-40045239 GAGCGCGCGCTCAGCGCCGCCGG - Intronic
1184276579 22:43412249-43412271 GCGCCCCTGCGCAGCGCCGCGGG - Intronic
1184337529 22:43862485-43862507 GCGCGCGGCGGCAGCTCCGCAGG + Exonic
1184681129 22:46072539-46072561 GCACGCGAGCGCGGCGCCGGCGG + Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
950282383 3:11719420-11719442 GCGGGCGCGCCCAGAGCCGCCGG - Intronic
950282558 3:11720036-11720058 GCGCGCGTGGGGAGCGCGGCGGG - Intronic
953657033 3:44862153-44862175 GCGGGCGGGCGGGGCGCCGCTGG + Intronic
953886615 3:46717780-46717802 TCGCGCGCGGGCAGCGCCCCCGG - Exonic
953989917 3:47475980-47476002 GCGCACGTGCGGAGGGCGGCGGG - Exonic
967904010 3:194486529-194486551 GGGCGGGTGGGCAGCGGCGCCGG - Intronic
968498556 4:932428-932450 CAGCGCGTGCGCGGCGTCGCCGG + Exonic
969379012 4:6782507-6782529 GCGCGCGGGCGGTGGGCCGCGGG - Intronic
969379019 4:6782524-6782546 GCGCGCGCCCGCAGCCCAGCCGG + Intronic
969413288 4:7043262-7043284 GCGCGCAGGCGCAGAGCGGCGGG + Intronic
970617598 4:17781986-17782008 GCGCGAGTGCACAGCGGGGCTGG + Intergenic
971257897 4:25030753-25030775 GCCCGCGTCTGCAGCGGCGCCGG - Exonic
972960642 4:44448403-44448425 GCGAGGGTGCGCAGGGCCCCGGG + Exonic
973635938 4:52862200-52862222 TCGCGCGCGCGGAGCGGCGCCGG + Intergenic
977694352 4:99949953-99949975 GGTGGCGCGCGCAGCGCCGCTGG - Intronic
978384689 4:108167904-108167926 GCGGGCGAGCGCGGGGCCGCCGG + Exonic
982616151 4:157637978-157638000 GCGCGGCTGCGCTGCGGCGCGGG - Intergenic
984024121 4:174522529-174522551 GCGCGCGCGTGCAGCCCGGCGGG + Exonic
985005994 4:185535630-185535652 GCGGGAGTGCGCAGCCCGGCCGG + Intergenic
985986162 5:3518336-3518358 GTGCGCGTGCACACCGCCACGGG + Intergenic
987050417 5:14143590-14143612 GCGCGCGGACGCAGAGCCCCGGG - Intergenic
987099805 5:14581871-14581893 GCGCCCGTCCGCAGCGCGGCCGG + Exonic
988577976 5:32444751-32444773 GCGCGCCTGCGCAGTGCGGTCGG - Exonic
997521640 5:134527244-134527266 GCGGGCGGGCGCCGCTCCGCAGG - Intronic
1003290703 6:4776334-4776356 GCGCGGGAGCGCGGCTCCGCAGG + Intronic
1003905351 6:10694433-10694455 CAGCGCGAGCGCTGCGCCGCTGG + Intronic
1006457739 6:34141684-34141706 GCGGGGGTGGGCAGGGCCGCGGG + Intronic
1007897459 6:45377664-45377686 GCGCGGGGGCCCAGCGACGCTGG + Intronic
1008932451 6:56954888-56954910 GCCCCCGGGCGCAGCCCCGCCGG + Intergenic
1012410123 6:98947635-98947657 GCGCGGGGGCGCGGGGCCGCGGG + Intronic
1019425684 7:975540-975562 GCGAGCGTACGCAGGGCGGCCGG + Exonic
1026665471 7:72336904-72336926 GCGCGCGTGGGGAGCGGCCCGGG - Intronic
1030048962 7:105521764-105521786 GCGCTCGGGCGCGGCGCCTCCGG + Intronic
1032062867 7:128739363-128739385 GCGCGCGTGAGCTGAGCCGGTGG + Exonic
1034475079 7:151277004-151277026 GGGCGCCGGCGCAGCGCGGCCGG + Intronic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1036578987 8:10055001-10055023 GGGCGCAGGCACAGCGCCGCGGG - Intronic
1037788891 8:21919663-21919685 GCGCGCAGGCGCAGCGGCGACGG + Exonic
1041693729 8:60714500-60714522 GCGCCCGTGCGCACCGCTGTAGG + Intronic
1049460836 8:142727040-142727062 GCGGCCGTGCGCGGCGCTGCAGG - Intergenic
1049802178 8:144522946-144522968 GGGCACGCGGGCAGCGCCGCCGG + Exonic
1052969937 9:34371231-34371253 GCGCTCGGGCACATCGCCGCCGG + Exonic
1055612025 9:78032422-78032444 GAGCGCGTGCGGGGCTCCGCGGG - Intergenic
1059191839 9:112333847-112333869 GCGCGCGCGCGCCGGGCCGAGGG - Intergenic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1185505778 X:631415-631437 GCGCGCGTGGGCACCGACACGGG + Intronic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1189473927 X:41334632-41334654 GCGGGAGTGCGCAGCGCGGCGGG + Intronic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG + Intronic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic