ID: 1060643861

View in Genome Browser
Species Human (GRCh38)
Location 9:125261775-125261797
Sequence GCGCGCGTGCGCAGCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060643861_1060643866 3 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643866 9:125261801-125261823 CGTGGCGGCAGCGCCGCTGCAGG 0: 1
1: 0
2: 1
3: 20
4: 192
1060643861_1060643867 10 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643867 9:125261808-125261830 GCAGCGCCGCTGCAGGACGCAGG 0: 1
1: 0
2: 2
3: 13
4: 146
1060643861_1060643870 22 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643870 9:125261820-125261842 CAGGACGCAGGGAAGCCAACAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1060643861_1060643871 29 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643871 9:125261827-125261849 CAGGGAAGCCAACAGGCGAGTGG 0: 1
1: 0
2: 1
3: 23
4: 219
1060643861_1060643868 11 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643868 9:125261809-125261831 CAGCGCCGCTGCAGGACGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060643861 Original CRISPR GCGCGCGTGCGCAGCGCCGC GGG (reversed) Intronic