ID: 1060643868

View in Genome Browser
Species Human (GRCh38)
Location 9:125261809-125261831
Sequence CAGCGCCGCTGCAGGACGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060643857_1060643868 21 Left 1060643857 9:125261765-125261787 CCCAGAGGCCCCCGCGGCGCTGC 0: 1
1: 0
2: 1
3: 35
4: 202
Right 1060643868 9:125261809-125261831 CAGCGCCGCTGCAGGACGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122
1060643860_1060643868 12 Left 1060643860 9:125261774-125261796 CCCCGCGGCGCTGCGCACGCGCG 0: 1
1: 1
2: 3
3: 13
4: 121
Right 1060643868 9:125261809-125261831 CAGCGCCGCTGCAGGACGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122
1060643861_1060643868 11 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643868 9:125261809-125261831 CAGCGCCGCTGCAGGACGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122
1060643859_1060643868 13 Left 1060643859 9:125261773-125261795 CCCCCGCGGCGCTGCGCACGCGC 0: 1
1: 0
2: 1
3: 20
4: 152
Right 1060643868 9:125261809-125261831 CAGCGCCGCTGCAGGACGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122
1060643862_1060643868 10 Left 1060643862 9:125261776-125261798 CCGCGGCGCTGCGCACGCGCGCT 0: 1
1: 0
2: 2
3: 17
4: 96
Right 1060643868 9:125261809-125261831 CAGCGCCGCTGCAGGACGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122
1060643858_1060643868 20 Left 1060643858 9:125261766-125261788 CCAGAGGCCCCCGCGGCGCTGCG 0: 1
1: 0
2: 1
3: 21
4: 274
Right 1060643868 9:125261809-125261831 CAGCGCCGCTGCAGGACGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060643868 Original CRISPR CAGCGCCGCTGCAGGACGCA GGG Intronic