ID: 1060643870

View in Genome Browser
Species Human (GRCh38)
Location 9:125261820-125261842
Sequence CAGGACGCAGGGAAGCCAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060643859_1060643870 24 Left 1060643859 9:125261773-125261795 CCCCCGCGGCGCTGCGCACGCGC 0: 1
1: 0
2: 1
3: 20
4: 152
Right 1060643870 9:125261820-125261842 CAGGACGCAGGGAAGCCAACAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1060643861_1060643870 22 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643870 9:125261820-125261842 CAGGACGCAGGGAAGCCAACAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1060643860_1060643870 23 Left 1060643860 9:125261774-125261796 CCCCGCGGCGCTGCGCACGCGCG 0: 1
1: 1
2: 3
3: 13
4: 121
Right 1060643870 9:125261820-125261842 CAGGACGCAGGGAAGCCAACAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1060643862_1060643870 21 Left 1060643862 9:125261776-125261798 CCGCGGCGCTGCGCACGCGCGCT 0: 1
1: 0
2: 2
3: 17
4: 96
Right 1060643870 9:125261820-125261842 CAGGACGCAGGGAAGCCAACAGG 0: 1
1: 0
2: 2
3: 15
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060643870 Original CRISPR CAGGACGCAGGGAAGCCAAC AGG Exonic