ID: 1060643871

View in Genome Browser
Species Human (GRCh38)
Location 9:125261827-125261849
Sequence CAGGGAAGCCAACAGGCGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060643861_1060643871 29 Left 1060643861 9:125261775-125261797 CCCGCGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 3
3: 14
4: 140
Right 1060643871 9:125261827-125261849 CAGGGAAGCCAACAGGCGAGTGG 0: 1
1: 0
2: 1
3: 23
4: 219
1060643860_1060643871 30 Left 1060643860 9:125261774-125261796 CCCCGCGGCGCTGCGCACGCGCG 0: 1
1: 1
2: 3
3: 13
4: 121
Right 1060643871 9:125261827-125261849 CAGGGAAGCCAACAGGCGAGTGG 0: 1
1: 0
2: 1
3: 23
4: 219
1060643862_1060643871 28 Left 1060643862 9:125261776-125261798 CCGCGGCGCTGCGCACGCGCGCT 0: 1
1: 0
2: 2
3: 17
4: 96
Right 1060643871 9:125261827-125261849 CAGGGAAGCCAACAGGCGAGTGG 0: 1
1: 0
2: 1
3: 23
4: 219
1060643869_1060643871 -10 Left 1060643869 9:125261814-125261836 CCGCTGCAGGACGCAGGGAAGCC 0: 1
1: 0
2: 1
3: 21
4: 250
Right 1060643871 9:125261827-125261849 CAGGGAAGCCAACAGGCGAGTGG 0: 1
1: 0
2: 1
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060643871 Original CRISPR CAGGGAAGCCAACAGGCGAG TGG Exonic