ID: 1060643898

View in Genome Browser
Species Human (GRCh38)
Location 9:125261942-125261964
Sequence CTCACCAAGGGGGTCATGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060643898_1060643906 2 Left 1060643898 9:125261942-125261964 CCCCGCATGACCCCCTTGGTGAG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1060643906 9:125261967-125261989 CGCGTCCCGATTTAGTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 3
1060643898_1060643909 12 Left 1060643898 9:125261942-125261964 CCCCGCATGACCCCCTTGGTGAG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1060643909 9:125261977-125261999 TTTAGTCCGCGGGCTGTGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 158
1060643898_1060643911 27 Left 1060643898 9:125261942-125261964 CCCCGCATGACCCCCTTGGTGAG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1060643911 9:125261992-125262014 GTGAGCGGCTCCCTGCCTCGCGG 0: 1
1: 0
2: 1
3: 6
4: 102
1060643898_1060643905 1 Left 1060643898 9:125261942-125261964 CCCCGCATGACCCCCTTGGTGAG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1060643905 9:125261966-125261988 ACGCGTCCCGATTTAGTCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 4

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060643898 Original CRISPR CTCACCAAGGGGGTCATGCG GGG (reversed) Exonic
900467601 1:2833313-2833335 CTCACCAAGGGTGTGATGGATGG + Intergenic
901324432 1:8358408-8358430 CTCTCCAAGGGGTTCAGGCCCGG + Exonic
904014173 1:27407510-27407532 CTCACCAAAGGGATCCTGGGAGG + Exonic
905286585 1:36884367-36884389 CTCCCCAAGGAGGCCATGCTCGG + Intronic
912493037 1:110072552-110072574 CTCAGCAAGGTTGTCATGGGAGG - Intronic
915030916 1:152879815-152879837 CTCACTATGGGGGACATGCTTGG + Intronic
1073446745 10:103585416-103585438 CTCACCTGGGGGGTGAGGCGAGG + Intronic
1074318014 10:112376475-112376497 TTCAGCAAGGGGGTCTTGTGAGG + Intronic
1090390703 11:126385440-126385462 CTCACCAGGTGGGTCAGGCGCGG - Intronic
1093631593 12:21416559-21416581 CTCACTGAGGGTGTCATGCTTGG + Intronic
1104570244 12:129918621-129918643 ATCACCAAGGAGGTCCTGGGAGG - Intergenic
1114253679 14:20983437-20983459 CTCAAAAAGGGGGTCCAGCGGGG + Intergenic
1118322091 14:64759280-64759302 CGCAGCCAGGGGGTCATGGGTGG - Intronic
1118856615 14:69628281-69628303 CTCACCACGTGGGTCATTTGTGG + Intronic
1122811280 14:104290566-104290588 CTCACCAAGCTGGCCATGGGGGG - Intergenic
1127468922 15:59273158-59273180 CTACCCAAGGGGGCCATGCGGGG - Intronic
1127832893 15:62766429-62766451 CACACCGAGGGGATCCTGCGAGG + Intronic
1131837086 15:96401733-96401755 CTCATCAAAGGGGTCATTCTTGG - Intergenic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1138920574 16:61523565-61523587 CTCACCAGGGAGGTCATCCCTGG + Intergenic
1147427812 17:40354634-40354656 CACAGCAAGGGGGCCATGTGGGG + Intronic
1157477353 18:48031810-48031832 CTCACCCAGAGGGTCATGGCAGG + Intronic
1160923482 19:1531738-1531760 CTCTCCCAGGGGGTCCTGTGTGG - Exonic
1162751671 19:12833539-12833561 CTCACCAAGGGGGTCTCTGGGGG + Intronic
1163014590 19:14446544-14446566 CTCACCTTGGGTGTCATCCGGGG - Exonic
1163133268 19:15289912-15289934 CTCAGCAAGGGGCTCAAGTGAGG + Intronic
1164764424 19:30753021-30753043 CTCAGCAAGGTGGTCATGGCAGG + Intergenic
933174440 2:79159599-79159621 CTCAGCAAGGGTGTCCTGGGAGG - Exonic
933945117 2:87279399-87279421 CACACCAAGTGGGTGATGGGTGG + Intergenic
935850735 2:107216209-107216231 TTCACAAAGGGGGCCAGGCGCGG + Intergenic
936073864 2:109389233-109389255 CTCAGCAAGAGGGGCAAGCGTGG + Intronic
944943356 2:204654097-204654119 CTCAGCAAGGAGGTGATGTGAGG + Intronic
1168946748 20:1767275-1767297 CTCTCCAAGGGGTTCAAGTGGGG - Intergenic
1173361390 20:42347543-42347565 CCCACCAATGGTGTCATGCCTGG - Intronic
1175189869 20:57204219-57204241 CTCATCAAAGGGGACATGAGTGG - Intronic
1175843979 20:62049051-62049073 GTGACCGAGGTGGTCATGCGGGG - Intronic
1181932714 22:26415636-26415658 CTCCCTAATGGGGCCATGCGGGG - Intergenic
961446841 3:126984970-126984992 CCCACAACGGGGGTCATGGGAGG - Intergenic
965648526 3:170909206-170909228 CTCACCAAGGGGTGAATGGGGGG - Intergenic
976028814 4:80725525-80725547 CTCACCATGGGGGTATTGTGTGG + Intronic
976878598 4:89889767-89889789 CTCACCAATGGGGTGAAGAGAGG + Intronic
990322055 5:54639833-54639855 CTGACCAAGGAGGTTATGCAAGG + Intergenic
1001360520 5:171080541-171080563 ATCACCAAGAGGATCATGTGAGG + Intronic
1008663683 6:53695245-53695267 CTCACCAGCGGGGTCTAGCGTGG + Intergenic
1010021102 6:71161052-71161074 CACACCAAGATGGTCATGTGGGG - Intergenic
1022259459 7:28690388-28690410 CTCACCAAGGGAAACATGTGAGG - Intronic
1033645894 7:143303824-143303846 CGCACCCAGGGGATCCTGCGTGG - Exonic
1034266149 7:149782002-149782024 CTCACCATGGGCCGCATGCGTGG - Intergenic
1034938434 7:155214568-155214590 CTCACCTGTGGGGTCATGCAGGG - Intergenic
1047941735 8:129832976-129832998 CTCAGGGAGGGGGTCATGGGAGG + Intergenic
1048970565 8:139643063-139643085 CTGGCCAAGGGGGTCAGGCAGGG - Intronic
1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG + Intergenic
1057183377 9:93041609-93041631 CTCTCCAAGGGGGCCAGGCCTGG - Intergenic
1060549791 9:124479507-124479529 CTCACCCAGCGGGTCATGTGAGG + Intergenic
1060643898 9:125261942-125261964 CTCACCAAGGGGGTCATGCGGGG - Exonic
1062126839 9:134868538-134868560 CTCACCAAGAGGGCAATGTGGGG + Intergenic
1190136757 X:47805450-47805472 CTCACCAAAGGGATCCTGGGAGG - Intergenic
1196046084 X:111257960-111257982 CTCAGAAGTGGGGTCATGCGGGG - Intronic