ID: 1060647873

View in Genome Browser
Species Human (GRCh38)
Location 9:125297561-125297583
Sequence CTTCTTGCTGTTCCTTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 3, 2: 15, 3: 51, 4: 282}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060647873_1060647878 10 Left 1060647873 9:125297561-125297583 CCTGTTCAAGGAACAGCAAGAAG 0: 1
1: 3
2: 15
3: 51
4: 282
Right 1060647878 9:125297594-125297616 TGGAGCTGTGTGAACTAGGGTGG No data
1060647873_1060647875 -10 Left 1060647873 9:125297561-125297583 CCTGTTCAAGGAACAGCAAGAAG 0: 1
1: 3
2: 15
3: 51
4: 282
Right 1060647875 9:125297574-125297596 CAGCAAGAAGGCAGATGTTCTGG No data
1060647873_1060647877 7 Left 1060647873 9:125297561-125297583 CCTGTTCAAGGAACAGCAAGAAG 0: 1
1: 3
2: 15
3: 51
4: 282
Right 1060647877 9:125297591-125297613 TTCTGGAGCTGTGTGAACTAGGG No data
1060647873_1060647876 6 Left 1060647873 9:125297561-125297583 CCTGTTCAAGGAACAGCAAGAAG 0: 1
1: 3
2: 15
3: 51
4: 282
Right 1060647876 9:125297590-125297612 GTTCTGGAGCTGTGTGAACTAGG No data
1060647873_1060647879 11 Left 1060647873 9:125297561-125297583 CCTGTTCAAGGAACAGCAAGAAG 0: 1
1: 3
2: 15
3: 51
4: 282
Right 1060647879 9:125297595-125297617 GGAGCTGTGTGAACTAGGGTGGG No data
1060647873_1060647881 24 Left 1060647873 9:125297561-125297583 CCTGTTCAAGGAACAGCAAGAAG 0: 1
1: 3
2: 15
3: 51
4: 282
Right 1060647881 9:125297608-125297630 CTAGGGTGGGATTGTAGGAGAGG No data
1060647873_1060647880 19 Left 1060647873 9:125297561-125297583 CCTGTTCAAGGAACAGCAAGAAG 0: 1
1: 3
2: 15
3: 51
4: 282
Right 1060647880 9:125297603-125297625 GTGAACTAGGGTGGGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060647873 Original CRISPR CTTCTTGCTGTTCCTTGAAC AGG (reversed) Intronic
901259366 1:7860373-7860395 CTCCTGGCTGTTCCTCAAACAGG - Intergenic
902556860 1:17252044-17252066 CTTCTTGCCTTTCCATGAATTGG + Intronic
905476715 1:38233859-38233881 GGTCTTGCTGTTACTTGAACAGG + Intergenic
906085596 1:43130975-43130997 CTTCTTTCTGTTCCTTGCACAGG + Intergenic
906443957 1:45877180-45877202 CTTCTTGCTGTTTCTTCACATGG + Intronic
906607151 1:47180607-47180629 ATTTTTGCTCTTCCTGGAACAGG - Intergenic
907263788 1:53241843-53241865 AGTCTTGCTCTTCCTTGACCTGG - Intergenic
907937432 1:59055308-59055330 GCTCTTTTTGTTCCTTGAACTGG - Intergenic
908727552 1:67193076-67193098 CTCCTTGCTGCTCTTTGAACAGG + Intronic
909531382 1:76685385-76685407 CACCTTGCTATTCCTTGAACAGG + Intergenic
912576958 1:110680849-110680871 CTACTTGCTGGTCCTTGGACAGG + Intergenic
912770361 1:112458203-112458225 CTGATTGCTGTTACTTGAATAGG + Exonic
913314186 1:117536256-117536278 CCTCTTGCTCTTCTTTGAATGGG - Intergenic
915030397 1:152875287-152875309 CTCCTTGCTGTTCCTGCAGCAGG - Intergenic
915153951 1:153859021-153859043 CTTTTTACTGTTGCTTGCACAGG - Intronic
915624631 1:157107140-157107162 CTTCTTCTAGTTCCTTGAAAAGG + Intergenic
916796606 1:168173316-168173338 CTTCTTGCTCTTCCTGAAATGGG + Intergenic
916950001 1:169770277-169770299 CTTCTTTTTGGTCCTTGAACAGG - Intronic
917255131 1:173107490-173107512 TTTCTTTCTGTTGCTAGAACAGG + Intergenic
918631210 1:186720523-186720545 CTTCTTGCTATTCCTTCACATGG - Intergenic
919658865 1:200223678-200223700 CTTCTTTCTGCTCCTTGAACAGG - Intergenic
920919695 1:210288285-210288307 CTCCTTGCTCTTCCTTGAACAGG - Intergenic
1065253528 10:23841334-23841356 GGCCTTGCTGTTTCTTGAACAGG - Intronic
1065513497 10:26503187-26503209 CTTCTTCCTCTTCCTGGAAAAGG - Exonic
1066433041 10:35371065-35371087 TTACTTGCTGTTCTTTGAAATGG + Intronic
1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG + Intronic
1068658998 10:59604027-59604049 CTTCTTTCAGTTCCTTGAACAGG - Intergenic
1069837885 10:71320505-71320527 CTTCTTGCTGTGCCTTCACATGG + Intronic
1071495044 10:86162354-86162376 CTTCTTCCTGTTCCCTGCATGGG - Intronic
1072270078 10:93767821-93767843 CTTCTTGCAGCTCATTCAACAGG + Intronic
1072372456 10:94778189-94778211 ATTCTTGATGTTCCCTGAAAGGG - Intronic
1073499351 10:103921919-103921941 CTCTCTTCTGTTCCTTGAACAGG - Intergenic
1073846351 10:107559978-107560000 CTGCTTAATGATCCTTGAACTGG - Intergenic
1075220648 10:120581606-120581628 CTTCTTGCTACTCCTTGAACAGG + Intronic
1076382644 10:130035952-130035974 CTTCTTGCTGTATCTTCACCTGG + Intergenic
1079140056 11:17802641-17802663 CTCCTTGCTCTTCCTCCAACTGG + Intronic
1079722007 11:23827027-23827049 CTTCTTGATGTAGCATGAACAGG + Intergenic
1080870992 11:36236869-36236891 GTTCTTGCTGTTCCCTTTACTGG + Intergenic
1081398448 11:42614597-42614619 CTTTTTGCTCTTCATTGAAAGGG + Intergenic
1083334325 11:61913939-61913961 TTTCCTGCTGTTCCTTAATCAGG - Intronic
1083409840 11:62484577-62484599 CTCCTTGCTGTTCCTTGATCTGG - Intronic
1083530541 11:63417887-63417909 CTCCCAGCTGTTCCTTGTACAGG - Intergenic
1084277649 11:68062788-68062810 TCTCTTTCTGTTTCTTGAACTGG - Intronic
1085464547 11:76715000-76715022 ACTCTTGCTCTTCCTTGAACAGG - Intergenic
1087084419 11:94202122-94202144 CTTCTTGCTGTCCCTTCACAGGG - Intergenic
1087559597 11:99770063-99770085 TCTCTTTCTGTTCCTGGAACAGG + Intronic
1087715134 11:101599822-101599844 TTTCTTGCTGTTTCTCAAACAGG + Intronic
1088415758 11:109587036-109587058 CTTCATGCTGTGCTTTGAATGGG - Intergenic
1088591971 11:111411318-111411340 CCCCTTGCCGCTCCTTGAACAGG + Intronic
1089097686 11:115932885-115932907 CTTTTTGCTTTTCCTGGAAGGGG + Intergenic
1089950241 11:122519009-122519031 CTTCCTGCTGTACCATGAAGTGG + Intergenic
1090438730 11:126708918-126708940 CTTCAGGCTGTTTCTTGAATTGG + Intronic
1091174872 11:133548845-133548867 CTTCTTTCAGTTCCTTAAATGGG - Intergenic
1092570727 12:9718744-9718766 CTTTTTGCTGTACCTTCAAATGG - Intronic
1092898086 12:13032934-13032956 CTTTTTGCTGGTCTTCGAACAGG + Intergenic
1094098414 12:26734705-26734727 CTGCTTGCTGTTCATTGTCCTGG + Intronic
1094669408 12:32554814-32554836 CTCCTTGCTATTCCTCCAACAGG - Intronic
1095800405 12:46266455-46266477 CTTCTTCCTGTTCCTTCCGCTGG + Intronic
1098859119 12:75687976-75687998 CTTCTTTCAGTTCTTTGAACAGG - Intergenic
1100358114 12:93850956-93850978 ATGCATGCTGGTCCTTGAACTGG - Intronic
1100815039 12:98378703-98378725 CTCTTTGCTGTTCCTTAAACTGG + Intergenic
1101298299 12:103450038-103450060 TTTCTTGCTGTTATATGAACTGG + Intronic
1102061326 12:109933968-109933990 TTTCTTGCTGTTCATTTAAAAGG + Intronic
1102069108 12:110002794-110002816 TGTGTTGCTGTTCCTGGAACAGG - Intronic
1102091264 12:110190286-110190308 CTCCTTACTGTTTCTTGAACTGG + Intronic
1103619253 12:122176301-122176323 CTCGATGCTGTTCCTAGAACGGG + Intronic
1104105301 12:125653413-125653435 GTTCTTGTTATGCCTTGAACTGG - Intronic
1104275028 12:127318978-127319000 GTTCTTGTTATTCCTTGAACTGG + Intergenic
1104426660 12:128683408-128683430 CTTCTTTCTCTTTCTAGAACAGG + Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106776327 13:33013813-33013835 TTACTTGCTGTGCTTTGAACAGG - Intergenic
1107594244 13:41945713-41945735 CTTCTTTCTGTTCCTTAGATTGG - Intronic
1110626047 13:77657439-77657461 CTTCTTGCTGTGCCTTCAAATGG + Intergenic
1110733327 13:78906695-78906717 ATTCTTGCTCTTTCTTGAAGAGG + Intergenic
1112429969 13:99342710-99342732 CTTGATGCTGTTCCTTTAGCTGG + Intronic
1113097783 13:106684143-106684165 CTTCTTGTTGGTCCTGGAGCTGG + Intergenic
1114202914 14:20539677-20539699 CTTCCTGCTGCTCCTTGTCCAGG - Intergenic
1114948891 14:27721675-27721697 TTTCTTTCTTTTCCTTGAGCAGG + Intergenic
1115616836 14:35103281-35103303 CTTCCTTCTGTTCCTAGAACAGG + Intronic
1116187470 14:41615725-41615747 CTTCTTGCTGATCCTGGACAAGG + Intronic
1117062276 14:51975242-51975264 CTTCTTGTTCTTCCTTGCACAGG - Intronic
1117714123 14:58563320-58563342 CTTCTTGCTGCTCCTTCCACTGG - Intergenic
1117874039 14:60232733-60232755 TTTCTTTCTGTTCCTTAGACTGG + Intergenic
1120811971 14:88812940-88812962 CTTCTTGCTGGTCCTTGAGTGGG - Intergenic
1122017785 14:98810845-98810867 CTTCTTCATTTTCCTTGAAAAGG - Intergenic
1122261395 14:100525173-100525195 CTACTTGCTGGTCCTGGTACTGG + Intronic
1123932037 15:25176626-25176648 CCTCTTCCTGTTCCTTGAGATGG + Intergenic
1124465349 15:29934322-29934344 CTTAATGCTGTACCTTAAACTGG - Intronic
1125886479 15:43233558-43233580 CTTTCTGCTGTTTCTTGAAGAGG + Exonic
1126936323 15:53712879-53712901 CATCTTGCTTTTCCTTCAAAAGG + Exonic
1127255475 15:57288401-57288423 CTTCTTGCTGCTGGTTGAAAAGG - Exonic
1128550346 15:68594339-68594361 CAGCTTGCTGTTCCTAGAAATGG - Intronic
1128680900 15:69650619-69650641 CTTCTTTCTGTTCCCTGAATGGG + Intergenic
1130158367 15:81373774-81373796 CTTCTGGCTGCTTCTTGACCAGG - Intronic
1130204492 15:81863711-81863733 CTTCTTGCTGTTCCCTCACTTGG + Intergenic
1130410293 15:83642002-83642024 TTTCTTTTTGTTCCTTGAACTGG + Intergenic
1130704172 15:86216883-86216905 CATCTCACTGTTCCTTGAACAGG + Intronic
1130904034 15:88227528-88227550 CTTCTTGCTGCCCCTTCACCTGG - Intronic
1131168860 15:90162236-90162258 CTTCTTTAAGTTCCTTGAATAGG + Intronic
1131998215 15:98153876-98153898 CTTCTGCCTGTGCCTGGAACTGG - Intergenic
1132251770 15:100340546-100340568 CTTCTCTCTGTACCTGGAACAGG - Intronic
1135231657 16:20714172-20714194 GCTCTTGCTGTTCCTGAAACTGG - Intronic
1135955714 16:26954860-26954882 CTTCTGTCTGTCCCTTGAAGGGG + Intergenic
1136057417 16:27700705-27700727 CTTCTTCCTGCTCCTTGATCAGG - Intronic
1138729439 16:59178621-59178643 CTTCTTTCTGTTCCATGATATGG + Intergenic
1138928368 16:61619845-61619867 CTTCTCTTTGTTCCTGGAACAGG - Intergenic
1139029125 16:62858001-62858023 CTTCTTGGTGATCCTTAAATTGG + Intergenic
1140610446 16:76592352-76592374 CTTCATGCTGTTCCATAAAGTGG - Intronic
1140896636 16:79330674-79330696 CTTCTGGCTGTTCAGTGAAGGGG - Intergenic
1143402969 17:6657730-6657752 CTTCCTGGTGTTTCTGGAACAGG - Intergenic
1144001969 17:11063696-11063718 CTTCTTGCTGTTTCTTCACACGG + Intergenic
1144050793 17:11495683-11495705 CTTCCTGCTGTTCCTGAAACAGG + Intronic
1144198801 17:12920577-12920599 CTTCCTTCTGTGCCTTGAAGAGG - Intronic
1144470085 17:15531491-15531513 TTTCTTTCTGTTCCTCGGACTGG + Intronic
1144926256 17:18812161-18812183 TTTCTTTCTGTTCCTCGGACTGG - Intergenic
1146486613 17:33248256-33248278 CTTCTCACTGTTCCTTGAACAGG - Intronic
1149801016 17:59567417-59567439 CTTCTTGATGCTCCTAAAACTGG - Intronic
1150950378 17:69797520-69797542 TTTCTTCCTGTCCCTCGAACAGG - Intergenic
1152538102 17:80961889-80961911 CATCTTGCTCTTCCTTTAATAGG - Intronic
1153280626 18:3411298-3411320 CCTCTTCCTCTTCCTTGACCTGG + Intergenic
1153280831 18:3412274-3412296 CCTCTTCCTCTTCCTTGACCTGG - Intronic
1157086814 18:44588830-44588852 GTTCTTTCAGTTCCTTGAACTGG + Intergenic
1157436420 18:47673565-47673587 CTTCTTGCTCTTCCTTGAAGGGG - Intergenic
1157572859 18:48724421-48724443 CTTCTCGCTGTTCTTTGAACAGG + Intronic
1157661260 18:49447191-49447213 CTTCTTTCAGGTCCTTGAACAGG - Intronic
1158131582 18:54158266-54158288 CTCCTTGCTGTTCCTTCTAATGG + Intronic
1159566478 18:70056653-70056675 CTCCTTGCTGTTTCTTGGATAGG + Intronic
1159641844 18:70872331-70872353 CTTCTTGGTGTTCTTTAACCTGG + Intergenic
1160796521 19:948173-948195 CTTCCTCCTGCTCCCTGAACCGG + Intronic
1161243343 19:3235102-3235124 CTCCTTGCTGTTTCTGCAACAGG + Intronic
1161257290 19:3316455-3316477 CTCCTCGCTGTTCCTCCAACAGG - Intergenic
1161321505 19:3643718-3643740 CTCCTTGCTGTTCCCTCAGCAGG + Intronic
1161492150 19:4567928-4567950 CTCCTTGCTGTTCCTCCAACAGG + Intergenic
1162575571 19:11496974-11496996 CTCCTCGCTGTTCCTGGAGCGGG + Intronic
1163999187 19:21081818-21081840 CTTCTTTCTGGTCTTTGAGCAGG - Intergenic
1165369196 19:35392140-35392162 CTTCTCTCTGTCCCTTGAGCAGG + Intergenic
1166262239 19:41648441-41648463 CTTTTTGCCCTTCCCTGAACAGG - Intronic
1166605861 19:44141966-44141988 CTCCTTGCTGTTCTTTAAAATGG + Intronic
1166816156 19:45547498-45547520 ACTCTTGCTGTTCCAGGAACAGG + Intronic
1168027811 19:53656124-53656146 CATCCTGCTCTTCTTTGAACTGG - Intergenic
1168660267 19:58160201-58160223 CCTCTTCCTGTTCCTTGACTTGG - Intergenic
926539785 2:14161072-14161094 CTTCTTGCTGTTCCTCTAGAAGG + Intergenic
926887055 2:17607427-17607449 CTTCATTCTGTCCCTTGAACAGG - Intronic
926970924 2:18466559-18466581 GCTCATGCTGTTCCTTGAGCTGG + Intergenic
928036298 2:27827106-27827128 CTCCTTGCTGTTCATTTCACTGG + Intronic
929611671 2:43275411-43275433 CTTCTTGCTTTTCCTGGCACTGG - Intronic
931341376 2:61404435-61404457 CTGCTTTCTGTTACTTGAAGCGG - Intronic
931793023 2:65682256-65682278 CTTCTTCCTGTTCCCTGTCCTGG - Intergenic
932448115 2:71793010-71793032 TTTCATGCTGTTCCTCCAACAGG + Intergenic
932464814 2:71912257-71912279 CTTCTTGCTGTGCCTTCACATGG - Intergenic
933699193 2:85242579-85242601 CTTCCTCCTTTTCCTTGAATGGG + Intronic
934489334 2:94749038-94749060 GTCCTTGTTGTTCCTAGAACAGG + Intergenic
935190317 2:100772386-100772408 CTTCTTGCTGTGCCTTCACATGG + Intergenic
935716321 2:105942495-105942517 CTTCCTGCTGTTACAGGAACCGG + Intergenic
938083678 2:128384533-128384555 CCTCTTGCTCATCTTTGAACTGG + Intergenic
938981349 2:136530253-136530275 CTTCACCCTGTTCCTTGAGCAGG + Intergenic
939212565 2:139195582-139195604 CTTCTTGCTCTTTCATTAACAGG + Intergenic
940025992 2:149209044-149209066 CTCCTTCCTGTTCATTGAAGAGG - Intronic
940149322 2:150581682-150581704 CTTCTTCAAGTTTCTTGAACAGG - Intergenic
940336837 2:152538214-152538236 CCTCTTCCTCTTCCCTGAACTGG - Intronic
942310881 2:174655558-174655580 CTTCTTTCAGTTCCATGAAAGGG + Intronic
942694203 2:178620937-178620959 CTTCCTGTTGTTCCTTCACCCGG + Exonic
942961301 2:181832453-181832475 CTTCTGTCTGTTCCCTGAACTGG + Intergenic
944318851 2:198312354-198312376 CTTCTTCCTGTCCCTTAAGCCGG - Intronic
944600474 2:201297992-201298014 CTCCTTGCTGTTCCCTTAACAGG - Intronic
944871651 2:203918291-203918313 CTTCCTGCTGTTGCTTGCCCTGG - Intergenic
945443202 2:209904944-209904966 CTTCTTTCTGTTTCTTGCCCCGG - Exonic
946135937 2:217646920-217646942 CTTCCTGCTGCTCCTACAACTGG + Intronic
947230054 2:227875497-227875519 CTCCTTGGTGTTCCTTGAATGGG + Intronic
948281543 2:236751081-236751103 CTTCTTGCTGTGTCTTCAAATGG + Intergenic
1168928481 20:1602000-1602022 CTTCTTGTAGTTTCTTGAAGTGG - Intronic
1170940417 20:20844122-20844144 CTTCCTCCTTTCCCTTGAACTGG + Intergenic
1172305109 20:33875219-33875241 CTTCTTCATGTTCCTTGATGGGG + Intergenic
1172498376 20:35406017-35406039 TTTCTTTCTGTTCCTTGGACTGG - Intronic
1172581449 20:36051587-36051609 CTCTTTGCTGTTCCTGGAACAGG - Intergenic
1173361871 20:42352014-42352036 CTTCCTGATTTTCCTTGAAGTGG - Intronic
1174160644 20:48547939-48547961 CTCCTGGCTGGTCTTTGAACTGG + Intergenic
1175039443 20:56033131-56033153 CTTCTTGCTGTGCCTTCACATGG + Intergenic
1175400257 20:58696200-58696222 CTTCCTGCTGTCCCTTAGACTGG + Intronic
1175960837 20:62635527-62635549 GTTCGTGCTGTTCCTTGTCCTGG - Intergenic
1177949027 21:27510721-27510743 CTTCTTGCAGTGCCTTCACCAGG + Intergenic
1177958121 21:27625977-27625999 CTTCTTGCATTTCCTTCAAGTGG - Intergenic
1178570164 21:33728527-33728549 CTTCTTCCTGTTCTTTAAATGGG + Intronic
1178808019 21:35855638-35855660 CTTCTGGCTGACCCTTTAACAGG + Intronic
1180502469 22:15945499-15945521 CTTTTTGCAGTTTCTGGAACTGG - Intergenic
1180502702 22:15949594-15949616 CTTTTTGCAGTTTCTGGAACTGG - Intergenic
1183457442 22:37930386-37930408 CTTCTTGCTGTGCCCAGACCTGG + Intronic
949102666 3:164799-164821 CGCCTTGCTATTCCTTGAATAGG - Intergenic
949208214 3:1466239-1466261 CTTCTTGCTGTTTCTTCACATGG - Intergenic
950683109 3:14598772-14598794 CTTCTTTCTCTTCCTCCAACAGG + Intergenic
950694663 3:14689732-14689754 TTGCTTGCTGTTCCTTGTTCCGG + Intronic
950792708 3:15486160-15486182 GTTCTTTCTGTTTCTTGAAGTGG + Intronic
951576436 3:24119567-24119589 CTTGTTGCTCCTCCATGAACAGG - Exonic
951766409 3:26204497-26204519 CTTCATCTTGTTCCTTGGACTGG + Intergenic
953491321 3:43354440-43354462 CTCCTTGCTAGTCCTTGAACAGG + Intronic
953980905 3:47412605-47412627 CTTCTGGCTGATGCTTGCACTGG - Exonic
955458500 3:59152258-59152280 CTTCTTTCCGTTCCTAGAAGAGG + Intergenic
956736139 3:72239800-72239822 ATTCTTGCTGTTCCTCCACCAGG + Intergenic
959470453 3:106743734-106743756 CTTGTGGCTTTTCCTTGAAATGG - Intergenic
959795830 3:110427362-110427384 CTTCTTTCTTTTCCTTCAGCTGG + Intergenic
961659401 3:128460505-128460527 CTTCTTGCTGTTCTCCAAACAGG + Intergenic
963390890 3:144662891-144662913 CTTCTTGCTGTGCCTTCACATGG + Intergenic
964071483 3:152638927-152638949 CTTCGTGCTGTTTCCTTAACTGG - Intergenic
964363564 3:155924602-155924624 TTTCTTGCTGTCTTTTGAACTGG - Intronic
964776791 3:160287882-160287904 CTAGTGCCTGTTCCTTGAACTGG - Intronic
966647572 3:182263501-182263523 CTTCTTGCTGTACCTTCATAAGG - Intergenic
967856299 3:194120002-194120024 CTCCTGGCTGTTCCTAGAGCAGG + Intergenic
969330041 4:6469343-6469365 CTACCTCCTGTTCCTTGAGCAGG - Intronic
969966184 4:10998762-10998784 CCTGTTGCTGTTCCTTCCACAGG - Intergenic
971256577 4:25019633-25019655 CTCCTTGCTATTCCTCCAACAGG + Intronic
971374659 4:26047272-26047294 CTCCTTGCCTTTCCTTGAACAGG - Intergenic
971629320 4:28969347-28969369 CTTCTTGCTGTGTCTTCATCTGG - Intergenic
971694590 4:29882982-29883004 CTCACTGCTGTTCCTTGAGCCGG + Intergenic
972999308 4:44925994-44926016 CTCCTTGCTGTCACTTGAATAGG - Intergenic
973024094 4:45245371-45245393 CTCCTTTCTGTTCCTCAAACAGG - Intergenic
973685401 4:53365159-53365181 CTTCTTCCTGTTCTTTGCAGGGG + Exonic
974684394 4:65206575-65206597 CTTCTTGCTGTGTCTTCAAATGG + Intergenic
976783401 4:88787772-88787794 CTTCATCCTGCTCCTTGGACTGG + Exonic
977189761 4:93985031-93985053 CTTCTTGCTGTGCCTTCACGTGG - Intergenic
977653971 4:99500952-99500974 CTTCTTGCTGTGCCTTCACATGG + Intergenic
978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG + Intronic
978654104 4:111046031-111046053 CCTCTAGCTGTTCCTTCAAGTGG - Intergenic
978676563 4:111325841-111325863 CTTCTTCCACTTGCTTGAACAGG + Intergenic
979484312 4:121253661-121253683 CTTCTTGCTGTATCTTCACCTGG + Intergenic
979611781 4:122697269-122697291 CTTCTTTCTCTTTCTTGCACTGG + Intergenic
980214740 4:129837250-129837272 GTTTTTGCTCTTCCTTGATCTGG + Intergenic
980412061 4:132433477-132433499 CTTTTTGCTGGTCCTGGAATAGG + Intergenic
980729522 4:136809200-136809222 CTTCTTGCTGTGCCTTAACATGG + Intergenic
982544231 4:156712594-156712616 CTTCTGCCTGGTCTTTGAACAGG + Intergenic
982560458 4:156923215-156923237 CTTCTTGCTGCTCCTTCACCAGG + Intronic
982971356 4:161992015-161992037 CTCCTTGATGCTTCTTGAACAGG - Intronic
983102798 4:163645781-163645803 ATTCTTTTTGTTCCTTGAATTGG - Intronic
983428100 4:167612956-167612978 CATTTTGCCTTTCCTTGAACAGG - Intergenic
984483270 4:180333429-180333451 CTCCTTGCTGTTCCTTGAACAGG - Intergenic
986777457 5:11030782-11030804 TTTGTTGTTTTTCCTTGAACTGG + Intronic
987953340 5:24704817-24704839 CATTTTCCTCTTCCTTGAACAGG + Intergenic
988842391 5:35095732-35095754 CATTTTGCTGTTTCTTGAGCAGG + Intronic
989669665 5:43900917-43900939 CTTTTTCCTTTTCTTTGAACTGG + Intergenic
989814092 5:45714351-45714373 CTTCTTCCTGTTGCTTGAAGAGG - Intergenic
990066438 5:51721126-51721148 ATTCCTGCTGCTCCTTCAACGGG - Intergenic
991316119 5:65308944-65308966 TTTATTGTTGTTCCTTGAAAAGG - Intronic
991998553 5:72412947-72412969 CTTCTTGCTGCTCCTTGGACAGG - Intergenic
993360341 5:86967327-86967349 CTGCTTTCTGTTCCCTGATCAGG + Intergenic
995637054 5:114205006-114205028 CTTCTTGCTTTTCATTCAGCTGG - Intergenic
995724104 5:115166863-115166885 CTCCTTGCTGTGGCTGGAACAGG - Intronic
997771899 5:136562860-136562882 CTTCTTGCTGTTTCTTCACATGG - Intergenic
998322098 5:141241917-141241939 CTACTTGCCGTTCCCTGAAGCGG + Intergenic
999097865 5:148996774-148996796 CTACTTGATCTTCCTTGCACGGG - Intronic
999448072 5:151657288-151657310 CTCCTTTCTGTTCCTGAAACAGG - Intergenic
999625705 5:153517988-153518010 CTTCCTTCAGTTCCTTAAACAGG + Intronic
1000998227 5:167980499-167980521 CTCTTTGCTGTTCCTTAAAGAGG - Intronic
1001129933 5:169055476-169055498 CTTTTTGCTGTTACTTGAATAGG - Intronic
1001783209 5:174388289-174388311 TTTCTTCCTGTTGCTTGAATTGG - Intergenic
1004114249 6:12750349-12750371 CTTGATGCTGTCCCTGGAACTGG + Intronic
1004177609 6:13353803-13353825 CTACTTCCTCTTCCTTGAATGGG - Intergenic
1005385753 6:25282432-25282454 CTCCTTGCTGTTCCTTGAACAGG + Intronic
1005880786 6:30058558-30058580 CTTCCTGCAGTTTCTTGATCCGG + Intergenic
1006194425 6:32229571-32229593 CTTCCTGCTGTTCTTGAAACAGG + Intergenic
1007500936 6:42296270-42296292 CTTTATGATGTTCTTTGAACTGG - Intronic
1009923354 6:70090904-70090926 GTTCTTGCTGTTCCCTCTACTGG + Intronic
1009993508 6:70873741-70873763 CTTTTTTCTGTTCCTTAAACTGG + Intronic
1010176356 6:73032686-73032708 TGGCTTGCTGTACCTTGAACTGG - Intronic
1010805369 6:80229437-80229459 CTTATTGCTGTTCCTCCAATAGG - Intronic
1012797227 6:103777689-103777711 CTTCATGATGTTCTTAGAACTGG - Intergenic
1012914727 6:105157193-105157215 CTTCCAGCTGCTCCTGGAACAGG + Intergenic
1013580307 6:111527510-111527532 CTTCTTGCTGTGCCTTCATATGG + Intergenic
1014090869 6:117402247-117402269 CTTCTAGTTGCTCCTTGATCAGG + Intronic
1016253944 6:142081112-142081134 CTTCTTGCTGTTTATTCAAATGG + Intronic
1016380759 6:143476232-143476254 CTCCTTGCTATTCCTTGAACAGG - Intronic
1016839600 6:148513248-148513270 CTTCCTACTGTTCCATGAACTGG + Intronic
1017114121 6:150960783-150960805 CTTCCTTCTGTTCCTTGGAAAGG - Intronic
1017172284 6:151468585-151468607 CTTCTTGTTGTCCTCTGAACTGG + Exonic
1018658400 6:166062749-166062771 CTTCTTGCTGTTTCATCACCTGG + Intergenic
1020543941 7:9499728-9499750 CTCCTAGCTATTTCTTGAACTGG + Intergenic
1020863968 7:13532681-13532703 CATCTCTCTATTCCTTGAACTGG + Intergenic
1021121449 7:16800381-16800403 CTTCGTGCTGTTCCTCCCACAGG - Intronic
1021455885 7:20829293-20829315 CTTCTTTCTGTTACTTAAATAGG + Intergenic
1021464047 7:20921639-20921661 CTTCTTTCTGTTGTTTGAAAGGG + Intergenic
1022146491 7:27547166-27547188 CTCCTTGCTGTTCTTGAAACAGG + Intronic
1022955116 7:35373680-35373702 CTTCTTGCTGTGCCTTCACTTGG + Intergenic
1024005486 7:45222403-45222425 CTTCTTGTTGTTCCTTGAACAGG + Intergenic
1024576864 7:50771497-50771519 CTGCTGGCTGTACTTTGAACTGG - Intronic
1024874533 7:54006862-54006884 GTTCTTGATGTTGCTTGAACTGG + Intergenic
1028656788 7:93218089-93218111 CTTCATGCTTTTCCTGGAACGGG - Intronic
1029045724 7:97626148-97626170 CTTCACTCTGGTCCTTGAACAGG + Intergenic
1030296660 7:107935486-107935508 CCTCTTGTTTTTCCTTGAACTGG + Exonic
1030298521 7:107952810-107952832 CTTCTTTCTCTTCCTTAAGCTGG + Intronic
1030631249 7:111898210-111898232 CTCCTTGCTATTCCTTGAAAAGG + Intronic
1031850662 7:126858870-126858892 CTCCTTTCTGTTCCTTGAACAGG + Intronic
1034364888 7:150537627-150537649 CTTCTTTTTGTTCCTCGTACTGG - Intergenic
1035116883 7:156532319-156532341 CTTCTTGCTGTGTCTTCACCTGG + Intergenic
1037013587 8:13875400-13875422 CTGATTGCTGTTCATTGAAGTGG - Intergenic
1037710855 8:21354412-21354434 CTACTTTCTGTTCCTTAAAAAGG - Intergenic
1037760518 8:21738662-21738684 CTTCTCTCTGTTCCTTGCAGAGG - Intronic
1038110063 8:24486678-24486700 CTTCTTGCTGTGTCCTGACCCGG + Intronic
1038133531 8:24759872-24759894 GTTCTTGTTTTTCCTAGAACAGG - Intergenic
1039148287 8:34474741-34474763 CTCCTTGCTGTTCCTCACACAGG - Intergenic
1039263749 8:35802268-35802290 CTCCTTGCTGCTCCTTGAATAGG - Intergenic
1040033861 8:42850143-42850165 CTCCTTGCTGTCCTTTGAGCAGG - Intronic
1041958663 8:63585973-63585995 GTTCTCATTGTTCCTTGAACAGG - Intergenic
1042080765 8:65048228-65048250 TGGCTTCCTGTTCCTTGAACTGG + Intergenic
1042828293 8:73000304-73000326 CTTCTTGCTATTCCTCAAATAGG - Intergenic
1043172091 8:76978443-76978465 TTTCTTGCTGTTCCTCAAAAAGG + Intergenic
1043719990 8:83535724-83535746 ATGCTTGCTTTTCCTAGAACAGG - Intergenic
1043732029 8:83694609-83694631 CTCCTTGCTGTGCCTGAAACAGG - Intergenic
1043766922 8:84147146-84147168 TTTCTTGCTGCTCTTGGAACAGG - Intergenic
1044386606 8:91596799-91596821 CTTCTTGCTCATCCTTGCATAGG + Intergenic
1044864043 8:96551895-96551917 CTTCTTCCTTTTTCTTAAACAGG + Intronic
1044873641 8:96643909-96643931 CTTTTTACTGCTCCATGAACAGG + Intergenic
1044902541 8:96963051-96963073 CTACTTACTGTTACTTAAACTGG - Intronic
1046239970 8:111477422-111477444 GTGCTGGCTGTTTCTTGAACAGG - Intergenic
1046564704 8:115884510-115884532 ATTCTTGCTGCTCTCTGAACTGG - Intergenic
1048382726 8:133881884-133881906 CATCTTTCTGTTCAATGAACAGG - Intergenic
1048508420 8:135041427-135041449 CTTTTTCCTCTTCCTTCAACTGG - Intergenic
1048865581 8:138759015-138759037 ATTCTTGCAGTTCCTTGACAGGG - Intronic
1051130073 9:13850875-13850897 CTTCTTGCTGTTCCCCAAAGTGG - Intergenic
1051448661 9:17170509-17170531 ATTCTTTCTGTTCCTCTAACTGG + Intronic
1051728728 9:20115556-20115578 CTTCTTTCTGTTCATTGTACAGG - Intergenic
1052498268 9:29256668-29256690 CTTCTTCCTTTTCCTTTCACAGG - Intergenic
1053463057 9:38285399-38285421 CATCTCAGTGTTCCTTGAACAGG + Intergenic
1053668450 9:40335245-40335267 GTCCTTGTTGTTCCTAGAACAGG - Intergenic
1054379590 9:64475297-64475319 GTCCTTGTTGTTCCTAGAACAGG - Intergenic
1055421022 9:76142467-76142489 CTCCTTGCTTTTCTTTGAACAGG - Intronic
1055434260 9:76276543-76276565 CTTCTTGATGTTCCTTGAAGGGG + Intronic
1055493326 9:76828286-76828308 TTGCTTTCTGTTCCTTGAACTGG - Intronic
1058457905 9:105155262-105155284 TTTCTTGCTTTTCCAGGAACGGG - Intergenic
1059165859 9:112075949-112075971 CTTCTTGCAGTTCCTTCAATGGG - Intronic
1060212255 9:121717799-121717821 CTTCCTGCTGTTCCTGGTCCAGG + Intronic
1060633604 9:125182082-125182104 CTACTTTCTAATCCTTGAACAGG + Intronic
1060647873 9:125297561-125297583 CTTCTTGCTGTTCCTTGAACAGG - Intronic
1061551407 9:131336910-131336932 CCTCTCGCTCTTCCTTGAACTGG - Intergenic
1186448219 X:9650317-9650339 CATCGTGCTGTGCCTGGAACAGG + Intronic
1187038455 X:15567065-15567087 CTCCTTGCTGTTCCTTTAACAGG + Intronic
1187081509 X:15994273-15994295 CTTTTTGCCATTCCTTGAGCTGG + Intergenic
1187762072 X:22598328-22598350 CTTCTTGCTGTACCTTCACATGG - Intergenic
1188148122 X:26639168-26639190 CTTCTTGCTATTCCTCAAACAGG + Intergenic
1189518051 X:41735682-41735704 CTCCTTGCTGTTCCTCGAGCAGG + Intronic
1189540557 X:41983408-41983430 CTCCTTGCTTGTCCATGAACAGG - Intergenic
1190457921 X:50643508-50643530 CTCCTTCCTGTTCTTAGAACTGG - Intronic
1190810914 X:53882447-53882469 CTCCTTGCTGGTTCTTGCACAGG + Intergenic
1192157327 X:68756399-68756421 CCTCATGCTGTCCCTTCAACAGG - Intergenic
1192840329 X:74848874-74848896 CTTCTTGCTGTTTCTTCATGTGG - Intronic
1194759641 X:97780017-97780039 TTTCTTTCTGTTCCTTAGACTGG - Intergenic
1196964259 X:121038609-121038631 CTGCTGGCTGGTCCTTCAACTGG + Intergenic
1197249789 X:124203199-124203221 TTTCTTTCTGGTCCTTGGACTGG - Intronic
1197712903 X:129684875-129684897 CTTCTTCCTGTTCCTCTAACAGG - Intergenic
1198409721 X:136354360-136354382 CTTCTTGCTGTGCCCTCAAGTGG + Intronic
1198478821 X:137022061-137022083 CTGTTTGCTGTTCCTTGGAGGGG + Intergenic
1198656323 X:138917362-138917384 CTTCTTGCTGTACCTTCACATGG - Intronic
1199408708 X:147494117-147494139 TTCCTTGCTGTTCCTTGAGCAGG - Intergenic
1200372860 X:155745367-155745389 CTTCATGATGATCCTTGTACCGG - Intergenic
1200816989 Y:7543693-7543715 GTTGCAGCTGTTCCTTGAACAGG - Intergenic