ID: 1060648247

View in Genome Browser
Species Human (GRCh38)
Location 9:125301189-125301211
Sequence CTGTAGGCCCAGCACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7310
Summary {0: 1, 1: 17, 2: 126, 3: 818, 4: 6348}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060648247_1060648254 27 Left 1060648247 9:125301189-125301211 CCTCCTGAGTGCTGGGCCTACAG 0: 1
1: 17
2: 126
3: 818
4: 6348
Right 1060648254 9:125301239-125301261 TCATATTTTTTTGTAGAGATGGG 0: 19
1: 174
2: 2620
3: 14181
4: 38944
1060648247_1060648255 28 Left 1060648247 9:125301189-125301211 CCTCCTGAGTGCTGGGCCTACAG 0: 1
1: 17
2: 126
3: 818
4: 6348
Right 1060648255 9:125301240-125301262 CATATTTTTTTGTAGAGATGGGG 0: 21
1: 226
2: 3137
3: 14228
4: 36005
1060648247_1060648253 26 Left 1060648247 9:125301189-125301211 CCTCCTGAGTGCTGGGCCTACAG 0: 1
1: 17
2: 126
3: 818
4: 6348
Right 1060648253 9:125301238-125301260 TTCATATTTTTTTGTAGAGATGG 0: 29
1: 222
2: 3313
3: 17855
4: 36769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060648247 Original CRISPR CTGTAGGCCCAGCACTCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr