ID: 1060648653

View in Genome Browser
Species Human (GRCh38)
Location 9:125305295-125305317
Sequence TAATTCCCACAGATGTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060648653 Original CRISPR TAATTCCCACAGATGTATTG AGG Intronic
905093463 1:35448542-35448564 GAATTCCCACACATGTGCTGGGG + Intronic
905837689 1:41142312-41142334 TGAATCCCTCAGATTTATTGAGG + Intronic
906614889 1:47227151-47227173 TACTTCCCACAGGTGTGCTGGGG + Intronic
906823581 1:48954885-48954907 TAATTCTCACTGATCTCTTGAGG - Intronic
908375113 1:63529176-63529198 TTATTCCCACAGTTTTATTTTGG - Intronic
909880758 1:80874651-80874673 TATTTTCCCCAGATTTATTGAGG + Intergenic
910048538 1:82948115-82948137 TAATTCACACAGATACATTAAGG - Intergenic
910984726 1:92994414-92994436 TATTTCTCTCAGATGTATGGCGG - Intergenic
911333299 1:96550387-96550409 CAATTCCCACAAGTGTAATGTGG + Intergenic
916412242 1:164558124-164558146 TAACTCACAAAGATGTCTTGGGG + Intronic
917485002 1:175447835-175447857 TCATTCCAACACATGTAATGTGG + Intronic
919079176 1:192849424-192849446 TAATTCATACAGTTGTTTTGAGG - Intergenic
919973952 1:202598942-202598964 TCATGCACACAGATGTATGGGGG - Intronic
919993703 1:202728295-202728317 TAATTGCCACAGCTGTATTTTGG - Exonic
920751669 1:208683767-208683789 TCATTCACTCAGACGTATTGAGG + Intergenic
923564070 1:235063524-235063546 TCACTTCCACACATGTATTGAGG + Intergenic
1068038124 10:51786724-51786746 TATTTCCTAAATATGTATTGTGG + Intronic
1068399056 10:56505253-56505275 TAATTCCTACTGATTTATTGTGG - Intergenic
1070431270 10:76340902-76340924 TAATTGTCACAGATGTCTTCTGG - Intronic
1070924229 10:80207566-80207588 AAATTCACACAGATTTCTTGGGG - Intergenic
1071374615 10:84989988-84990010 TATTTCCCTAGGATGTATTGAGG + Intergenic
1071958661 10:90786369-90786391 TTTTTCCCACATATGTATTTTGG + Intronic
1073069831 10:100786394-100786416 TAATGTCCACAGATGAATAGAGG - Intronic
1078356296 11:10634204-10634226 TTATTCCCCCAGCTTTATTGAGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080343919 11:31299825-31299847 TACATCCCACAGATGTATTATGG - Intronic
1083088040 11:60170258-60170280 CAAATCCCAGCGATGTATTGGGG + Intergenic
1083870734 11:65486930-65486952 TAAGTTCCACAGATTTATTACGG + Intergenic
1085755576 11:79198693-79198715 TAATTGACAAATATGTATTGGGG + Intronic
1087259248 11:95992512-95992534 TAATTCCCAATGATGTATTTAGG + Intronic
1089568432 11:119385672-119385694 GAATTCCCACAAATGCAGTGTGG + Intergenic
1090325091 11:125879172-125879194 TAACTCCCACACATGTGGTGTGG - Intergenic
1091202732 11:133794622-133794644 GAATTCCCTCAGATTTATTCTGG - Intergenic
1092534310 12:9373462-9373484 GAAATCCCACAGATTTCTTGTGG - Intergenic
1095141034 12:38662266-38662288 TAGTTCCGACAGTTGTATTGTGG - Intronic
1095241873 12:39869926-39869948 TACTTCACAGAGATGTAATGAGG - Intronic
1097391303 12:59017872-59017894 TAAATCAAACAGATATATTGGGG + Intergenic
1097635591 12:62117506-62117528 TATTTCCAACAGATGTGTTTAGG + Intronic
1098702094 12:73641963-73641985 TTTTTCCCTCAGATTTATTGAGG + Intergenic
1101482518 12:105113094-105113116 TGATTCTCACAGAAGTGTTGAGG - Intronic
1102408968 12:112700555-112700577 TAATTCCCATAGAGGGATAGGGG - Intronic
1103335145 12:120183809-120183831 GAATTGCCACAGATGGTTTGTGG - Intronic
1104214588 12:126723619-126723641 TATTTCCAACCGATGGATTGGGG - Intergenic
1104569484 12:129912424-129912446 AGATTCCCACAGATGAATTCTGG + Intergenic
1105683952 13:22759127-22759149 CACTTCCCACAGATGTATATTGG - Intergenic
1106223521 13:27767599-27767621 TGATTCCAACATATGTATTTTGG + Intergenic
1106379337 13:29221532-29221554 TAATTCCCACATTTCTATTTGGG + Intronic
1109369188 13:61399045-61399067 TACATACCACAGATGTTTTGTGG + Intergenic
1109380273 13:61550526-61550548 TAAATCCCACAGAAGTTTAGGGG + Intergenic
1111002507 13:82204686-82204708 TTGTTCACACACATGTATTGTGG - Intergenic
1111033143 13:82633396-82633418 TAATTCCCACAGGTAACTTGCGG - Intergenic
1114231107 14:20783608-20783630 GAAATACCACAGAAGTATTGGGG + Intergenic
1115686968 14:35806144-35806166 TAATTCTGACAGCTTTATTGAGG - Intronic
1116446169 14:45014550-45014572 TGATTCCTACAAATTTATTGTGG + Intronic
1116591309 14:46778634-46778656 TAAATCCCACAGATGAATGTTGG + Intergenic
1118066272 14:62194129-62194151 TCATTCCAATAGATGTATTGTGG + Intergenic
1118773755 14:68960498-68960520 TAATTCCCCCAGCTTTATTGAGG - Intronic
1120181287 14:81345024-81345046 TACTTCCCACAGATGTAATAAGG - Intronic
1121005116 14:90485345-90485367 AAATTCCCACAGAAGTATTTAGG + Intergenic
1124403103 15:29367570-29367592 GTATTCCCAGAGATATATTGGGG - Intronic
1125371062 15:38977321-38977343 TAATTCTCACTTATGTCTTGGGG + Intergenic
1127690453 15:61390879-61390901 TAATTTCCATATATGTATTATGG + Intergenic
1127889088 15:63232250-63232272 TATTTCCCAGAGATATATTAAGG + Intronic
1134215721 16:12315684-12315706 TACTTCCCACAGTTGTAGAGGGG - Intronic
1135830266 16:25766817-25766839 TACTTCACAGAGATGTCTTGAGG - Intronic
1137002057 16:35237709-35237731 GAATTTCCAGAGATGTAGTGGGG - Intergenic
1139022773 16:62772389-62772411 TAATCCCCAGAGATGTACTAGGG - Intergenic
1139062361 16:63268083-63268105 TAATGCCCACAGATGTATGAAGG - Intergenic
1142436604 16:90063081-90063103 TAATCCACACAGAAGCATTGGGG - Intronic
1143905462 17:10205545-10205567 TGAATCCCATAGATGTAATGTGG + Intergenic
1145817819 17:27808138-27808160 CAATGCCCACAGATGAATTTAGG - Intronic
1148119387 17:45198862-45198884 TAATACCCACTGAAGTATTTGGG - Intergenic
1149294738 17:55251906-55251928 TGAATCCCACAAATGTAATGTGG - Intergenic
1150516391 17:65814487-65814509 TAATTTACAGAGATGTAGTGAGG + Intronic
1154067809 18:11125536-11125558 TGGTTTCCGCAGATGTATTGAGG - Intronic
1155480095 18:26276863-26276885 AAATTCACACATATGTTTTGTGG - Intronic
1159966759 18:74602580-74602602 TAATTCCCCCAAATCTTTTGAGG + Intronic
1159980908 18:74778238-74778260 TCATTCTCACAGATGTGATGTGG - Intronic
1164252537 19:23493858-23493880 AATTTTCCACAGATGTATTTTGG - Intergenic
1164297951 19:23932155-23932177 CATTTCCCACAGATGTATTTTGG + Intronic
1164319261 19:24126063-24126085 AATTTTCCACAGATGTATTTTGG + Intronic
927119593 2:19944553-19944575 AAATTCCCACAATTGTTTTGTGG + Intronic
927295424 2:21447579-21447601 TAATTCCCTCAGATGTGTAGCGG + Intergenic
930974246 2:57436004-57436026 TAATTCTCATAGAAGTATTTTGG + Intergenic
933884393 2:86704569-86704591 TAATTCCCTCACATTGATTGTGG + Intronic
935308188 2:101758517-101758539 CAATTCCCACAGATGCTCTGTGG - Intronic
936859566 2:117001227-117001249 TATTTCCAACAGAGGTACTGGGG + Intergenic
939510568 2:143099519-143099541 TAAGTAACACAGATGTATTCAGG + Intronic
939559861 2:143719675-143719697 TATTCCCCACAGAGATATTGAGG + Intronic
942014565 2:171798867-171798889 TAGTTCCAACATATGCATTGTGG - Intronic
942744679 2:179218196-179218218 TAATCCACTCAGATGTATTTAGG - Intronic
943371081 2:187016768-187016790 TAATTCCCACATGTGAATTGTGG + Intergenic
945515297 2:210756628-210756650 TGATTCCCACATATTTATTGGGG + Intergenic
946823844 2:223656472-223656494 CAATTTCCACATCTGTATTGAGG + Intergenic
1173511329 20:43631227-43631249 GACTTTCCACAGTTGTATTGAGG + Intronic
1173757129 20:45526353-45526375 CAATTCTCACAGAGGTATGGAGG + Intergenic
1174718052 20:52781325-52781347 TAATTCAAAGAGAAGTATTGTGG - Intergenic
1175580336 20:60093988-60094010 AAATTCCCACTGATGTAAAGTGG + Intergenic
1183122786 22:35743241-35743263 GATTTCCCCCAGATGTCTTGAGG - Intronic
1183997430 22:41645616-41645638 TAATTCCCAAAGAAAAATTGGGG + Intronic
953445670 3:42963198-42963220 TAAATCTCACAGATATATTGTGG - Intronic
956070237 3:65441650-65441672 TCTTTCTCACAGATGTACTGTGG - Intronic
956323768 3:68027849-68027871 TAATTCCCAAACATGAATTGAGG + Intronic
957475970 3:80724568-80724590 GAATTCACTTAGATGTATTGTGG - Intergenic
959192628 3:103134386-103134408 TAATTTTCCCAGATTTATTGAGG + Intergenic
962293673 3:134160227-134160249 TGATTCTCACAGGTTTATTGAGG - Intronic
962351550 3:134660113-134660135 TAATTCACAGAGAAATATTGAGG + Intronic
966589988 3:181671692-181671714 TAATTTCTACAGATTAATTGAGG - Intergenic
967870558 3:194225573-194225595 TAATCCTCACAGCTGTGTTGTGG - Intergenic
968053319 3:195671612-195671634 TGATACCCACAGATGTTTTTCGG + Intergenic
970531063 4:16984637-16984659 TAGTTCCCATAGATTTTTTGAGG - Intergenic
970687794 4:18588186-18588208 GAATTCCCACAGATGTTAAGTGG - Intergenic
970847104 4:20553655-20553677 AAATCCCCATAGATTTATTGAGG - Intronic
973143725 4:46799005-46799027 TTATTAACACAGAAGTATTGGGG + Intronic
974712420 4:65617025-65617047 TATTTCCCAAACTTGTATTGTGG + Intronic
975052776 4:69886199-69886221 TATTTCACACATATTTATTGAGG + Intergenic
978211450 4:106142215-106142237 TAATTCAGATAGATGTATTTTGG + Intronic
981240423 4:142469763-142469785 TAATTCCTTCAGATGTCTGGTGG + Intronic
981365715 4:143900432-143900454 TAATACTCAAAGATGTATAGGGG - Intronic
981375812 4:144014239-144014261 TAATACTCAAAGATGTATAGGGG - Intronic
981386338 4:144135625-144135647 TAATACTCAAAGATGTATAGGGG - Intronic
981487344 4:145301315-145301337 TCATTCCCAAAGATCTACTGGGG - Intergenic
985095569 4:186409347-186409369 TCTCTCCCACAGATGTGTTGGGG - Intergenic
985201649 4:187490408-187490430 TCATTCTCACATATGTGTTGTGG - Intergenic
985499563 5:233957-233979 TGATACCCACAGATGTTTTTTGG + Intronic
985832340 5:2243023-2243045 TAATTCACATAGATGGATTTGGG + Intergenic
987304750 5:16626876-16626898 TAATTCCCACAGCAGTCTCGAGG - Intergenic
988096344 5:26615815-26615837 TAATTCTATAAGATGTATTGTGG + Intergenic
988845828 5:35126843-35126865 TATTTCCTAGAGATGTTTTGAGG - Intronic
989804924 5:45591458-45591480 TCATTCTCATAGATGTATAGTGG + Intronic
990090760 5:52044678-52044700 TAATTCCCCCACATGTATTTAGG + Intronic
990324963 5:54666165-54666187 TTCTTCCCACAGATATATTCTGG - Intergenic
990367169 5:55082864-55082886 CAAATCCCACAGATGTTCTGGGG + Intergenic
990540395 5:56766715-56766737 TAAATCCCACAGACATGTTGAGG - Intergenic
992346250 5:75881248-75881270 TAATTTCCTCAGATTAATTGAGG - Intergenic
993887769 5:93436554-93436576 TATTTCCAACTGCTGTATTGAGG + Intergenic
994281320 5:97906498-97906520 TAAAGCCCACAGAAGTATGGGGG + Intergenic
995948840 5:117684858-117684880 TATTTCCCAATGATGTATTATGG + Intergenic
996030158 5:118695817-118695839 AAATTTACACAGATTTATTGAGG - Intergenic
1001081473 5:168670901-168670923 TAATTCCCACAGAGACAGTGGGG + Intronic
1001340517 5:170839312-170839334 TGTTTCACACAGATGCATTGTGG - Intergenic
1002370621 5:178750947-178750969 TGTTTCACACAGATGCATTGTGG + Intergenic
1005534180 6:26738085-26738107 TGATTCCCACACCTGTCTTGTGG + Intergenic
1005536615 6:26763569-26763591 TGATTCCCACACCTGTCTTGTGG - Intergenic
1009007515 6:57805983-57806005 TGATTCCCACACCTGTCTTGTGG - Intergenic
1010285230 6:74069442-74069464 TAATTCCCACAGACGTTTGCTGG - Intergenic
1013015903 6:106160419-106160441 TAGATCCCACAGATGTACTTTGG + Intergenic
1014126925 6:117787009-117787031 TTATTCACACAGTTGTGTTGAGG + Intergenic
1016037137 6:139394945-139394967 TAATTCTAACAAATGTAGTGAGG - Intergenic
1017313880 6:153005908-153005930 TAATGCCCATAGATGTATATGGG + Exonic
1017462288 6:154662728-154662750 CAATTCCCACATGGGTATTGGGG - Intergenic
1021222749 7:17992292-17992314 CAATTCTCACATATATATTGGGG - Intergenic
1022744527 7:33157046-33157068 TAATTGCCAAAGAAGTATTCTGG - Intronic
1029974374 7:104818837-104818859 TAAATCTCAAAGGTGTATTGGGG - Intronic
1031284631 7:119850063-119850085 TGATACACACAGATGTATTCAGG + Intergenic
1032766769 7:135001425-135001447 CAATTGCCACAGATGATTTGAGG + Intronic
1033717735 7:144020354-144020376 AAACTCCCACAAATGTATAGTGG + Intergenic
1033848131 7:145460632-145460654 TAATTCTCACAGAAGATTTGAGG + Intergenic
1037191181 8:16127753-16127775 CAATTCCCACAGATGGCTTCAGG - Intronic
1039099305 8:33923645-33923667 TACTTCCCAAGGATATATTGAGG + Intergenic
1039185390 8:34910215-34910237 CCATTCCCACAGATGCATTTTGG + Intergenic
1043156871 8:76793551-76793573 TAATTCCAGCAGATGAATTTGGG + Intronic
1043355217 8:79403576-79403598 TAAATCCCAGATATGTTTTGGGG - Intergenic
1046565828 8:115899855-115899877 TAATCCTCACAGATGGATGGCGG - Intergenic
1048537103 8:135307080-135307102 TAATTTCCACAAATGCATTGTGG + Intergenic
1051923634 9:22297931-22297953 GAATTCAAACAGCTGTATTGAGG - Intergenic
1052028041 9:23596309-23596331 GAATTCCCACAGCTGTTTTGAGG + Intergenic
1052682598 9:31713309-31713331 AAATTCCAAAAAATGTATTGGGG - Intergenic
1055261841 9:74446238-74446260 AAATACACACAGATGTATTTAGG + Intergenic
1060648653 9:125305295-125305317 TAATTCCCACAGATGTATTGAGG + Intronic
1186161846 X:6785191-6785213 TAATTCCCTAAAATGTGTTGTGG + Intergenic
1187475276 X:19605171-19605193 TAATTCCCAGTCATGTCTTGGGG - Intronic
1188917502 X:35931195-35931217 TAATTTCCACAGGTTTATTATGG + Intronic
1192089962 X:68143659-68143681 TAATTGGCACAGGTTTATTGGGG - Intronic
1192640045 X:72853320-72853342 CAATTCTCACAGAGGTATTTAGG - Intergenic
1192641666 X:72867485-72867507 CAATTCTCACAGAGGTATTTAGG + Intergenic
1193670622 X:84381116-84381138 TAATTCCTACGTATTTATTGTGG - Intronic
1193745971 X:85281638-85281660 TAAATCCCACAGTTATAGTGAGG - Intronic
1194012400 X:88578655-88578677 TTATTTCCACAGGTGTTTTGAGG - Intergenic
1197012835 X:121588033-121588055 TAATTGCCATAGATATACTGAGG - Intergenic
1199014518 X:142798499-142798521 TAATTCCAATGGATGTATAGTGG - Intergenic