ID: 1060651495

View in Genome Browser
Species Human (GRCh38)
Location 9:125331186-125331208
Sequence AAAATTATAAAACACATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1197
Summary {0: 1, 1: 0, 2: 3, 3: 79, 4: 1114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060651495_1060651499 29 Left 1060651495 9:125331186-125331208 CCTGATATGTGTTTTATAATTTT 0: 1
1: 0
2: 3
3: 79
4: 1114
Right 1060651499 9:125331238-125331260 TCACCCAGGCTGGAGTGCAGTGG 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
1060651495_1060651498 19 Left 1060651495 9:125331186-125331208 CCTGATATGTGTTTTATAATTTT 0: 1
1: 0
2: 3
3: 79
4: 1114
Right 1060651498 9:125331228-125331250 TCTCACTCTGTCACCCAGGCTGG 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
1060651495_1060651496 -6 Left 1060651495 9:125331186-125331208 CCTGATATGTGTTTTATAATTTT 0: 1
1: 0
2: 3
3: 79
4: 1114
Right 1060651496 9:125331203-125331225 AATTTTTTTTTTTTTTGAGATGG 0: 1437
1: 8325
2: 111327
3: 81061
4: 100906
1060651495_1060651497 15 Left 1060651495 9:125331186-125331208 CCTGATATGTGTTTTATAATTTT 0: 1
1: 0
2: 3
3: 79
4: 1114
Right 1060651497 9:125331224-125331246 GGAGTCTCACTCTGTCACCCAGG 0: 10947
1: 44694
2: 106698
3: 138738
4: 144268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060651495 Original CRISPR AAAATTATAAAACACATATC AGG (reversed) Intronic
900211443 1:1458138-1458160 AAAAATACAAAAAACTTATCTGG - Intronic
901243570 1:7710436-7710458 AAAAATTTAAAACAAATAGCTGG + Intronic
901465929 1:9421091-9421113 AAACATATAAAAAACATATTTGG - Intergenic
901706578 1:11078111-11078133 AAAATTAAAAAAAACATAGCTGG + Intronic
902098634 1:13966893-13966915 AAAATTAAAAATTACATATATGG + Intergenic
902428023 1:16340199-16340221 AAAATTAAAAATCACCTAGCAGG + Intronic
902563610 1:17295282-17295304 AAAATTGCAAAATACACATCTGG - Intergenic
902951526 1:19886923-19886945 AAAATTTTAAATCACATACGTGG - Intronic
903209221 1:21806950-21806972 AAAAATACAAAAAAAATATCTGG - Intergenic
903534014 1:24054657-24054679 AAAATTAAAAAAAAAAAATCTGG - Intergenic
904040064 1:27578674-27578696 AAAATTTTAAATTACATATGTGG + Intronic
904309188 1:29615103-29615125 ACATTTGAAAAACACATATCTGG - Intergenic
904589311 1:31600854-31600876 GAAATTTAAAAACACATTTCTGG - Intergenic
904775759 1:32905424-32905446 AAAAGTATAAAGCAGAAATCAGG + Intergenic
905111942 1:35601800-35601822 AACATTCTGAAACACACATCTGG + Exonic
905498250 1:38413797-38413819 ATATTTGAAAAACACATATCTGG + Intergenic
905781485 1:40714552-40714574 AAGATTATAATAGACATAGCTGG + Intronic
906282626 1:44564845-44564867 AACCTTATAAAACACAAGTCTGG + Intronic
906352412 1:45073872-45073894 AACATAATAAAAGACATATATGG - Intronic
906417383 1:45631177-45631199 AAAACTATAAAACTCCTATAAGG + Intronic
906972003 1:50525185-50525207 AAACTTTTAAAATACATATGGGG - Intronic
906994535 1:50777557-50777579 AAAATGAAAAAACACAGATACGG + Intronic
907379316 1:54072738-54072760 AAATTTATAAAAAACATTTTGGG - Intronic
907382957 1:54106349-54106371 AAAATTAAAAAATACATATGTGG - Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907896641 1:58699055-58699077 ATAATTATAAACAACATAGCTGG + Intronic
908008500 1:59751590-59751612 AAAATTATTAAAAACACACCTGG - Intronic
908358138 1:63342170-63342192 AAAAATATAAAAAAATTATCCGG + Intergenic
908368594 1:63455814-63455836 AAAATTTTAAATTACATATATGG - Intronic
908482489 1:64555822-64555844 AATATTTGAAAACACATATGGGG - Intronic
908733191 1:67248196-67248218 CAAGTTGTAAAACACATTTCAGG - Intronic
908756662 1:67474853-67474875 AAAATTTTAAATTACATATGTGG - Intergenic
908928571 1:69288031-69288053 AAAATTCTATAACAGACATCTGG + Intergenic
908971050 1:69832197-69832219 AACAGTGTAAAACACATACCAGG + Intronic
908992221 1:70105387-70105409 AAAATAAGAAAACACAAATAAGG + Intronic
909024791 1:70469395-70469417 CAACTTGGAAAACACATATCAGG + Intergenic
909160396 1:72140950-72140972 CAAATTATCTAACACATATTAGG - Intronic
909200248 1:72682660-72682682 AAAATTTTAAATGACATATGTGG - Intergenic
909322155 1:74303322-74303344 AAAAATAGAAAAAAAATATCTGG - Intronic
909328739 1:74386651-74386673 AAAATTATATATCAAATAACTGG + Intronic
909470922 1:76027416-76027438 AAAATTAAAAAGCAAATATACGG + Intergenic
909508732 1:76426202-76426224 GAAAATAGCAAACACATATCAGG - Intronic
909705972 1:78585073-78585095 ATATTTATAAATCACAGATCTGG + Intergenic
909876711 1:80814382-80814404 AAAAATAAAAAAGACATTTCAGG + Intergenic
909955059 1:81769308-81769330 AAAATGCTAAAACACAGATAAGG - Intronic
910121175 1:83792040-83792062 ACAGTTATAAAAAACAAATCTGG + Intergenic
910160792 1:84270285-84270307 AAAATTAAAAGTTACATATCTGG - Intergenic
910220214 1:84882306-84882328 AAAACTATAAAACACTGATAAGG + Intronic
910306019 1:85764759-85764781 AAATTAAAAAAACACACATCAGG - Intronic
910529397 1:88218326-88218348 GAAATTAGAAAACAGATAACTGG - Intergenic
910890898 1:92018911-92018933 AAAATTATAAAATTCATAATTGG - Intergenic
911700202 1:100943707-100943729 AATATTACAAAATACATATTTGG - Intronic
911760363 1:101607610-101607632 AAAATTATAAAATATTTATTAGG + Intergenic
912217940 1:107637301-107637323 AAAATTATAAAACAAACATATGG - Intronic
912919596 1:113853319-113853341 AAAATTTAAAATCACATATGTGG - Intronic
913061812 1:115215649-115215671 AAAATTATAAATGAAATATTTGG - Intergenic
913168076 1:116207799-116207821 TAAAATATTATACACATATCAGG - Intergenic
913479153 1:119268664-119268686 ATATTTTTAAAACACATATCTGG + Intergenic
913663506 1:121026579-121026601 AAAATTATAAAATTCTTATGGGG + Intergenic
913681413 1:121189086-121189108 AAAAAAAAAAAAGACATATCTGG - Intronic
914014898 1:143809858-143809880 AAAATTATAAAATTCTTATGGGG + Intergenic
914033243 1:143976727-143976749 AAAAAAAAAAAAGACATATCTGG - Intergenic
914156203 1:145091239-145091261 AAAAAAAAAAAAGACATATCTGG + Intronic
914162924 1:145151357-145151379 AAAATTATAAAATTCTTATGGGG - Intergenic
914381768 1:147122793-147122815 AAGATTTTAAAAATCATATCTGG + Intergenic
914385373 1:147164467-147164489 AAAAATAAAAAATACATATAAGG + Intronic
914653518 1:149718397-149718419 AAAATTATAAAATTCTTATGGGG + Intergenic
915765529 1:158358318-158358340 AAAATTAAAAAAAAAATAGCCGG - Intergenic
915834601 1:159165765-159165787 AAAATTATAAAACGTACTTCAGG + Intergenic
916218662 1:162421164-162421186 AAAATGCTGAAACAAATATCAGG + Intergenic
916524240 1:165594251-165594273 AAAATTTTAAATTACATGTCTGG + Intergenic
916781700 1:168038284-168038306 AAATTTATAAAACTTATATTAGG - Intronic
917061901 1:171050230-171050252 AAAATTATAAAAGAAAAATTAGG - Intronic
917263450 1:173194731-173194753 AAAATAATAAAAAAAATAGCTGG + Intronic
917340153 1:173967766-173967788 AAAATTATAAAACTAAGATATGG - Intronic
917367080 1:174243907-174243929 CATATTATAAAACACAAATGTGG + Intronic
917983571 1:180291609-180291631 ATATTTATAAAACATATATTTGG - Intronic
918393120 1:184087143-184087165 AAAATTTTAAATTACATATGTGG - Intergenic
918519648 1:185401484-185401506 AAAAATGTAAAACACATACATGG - Intergenic
918597931 1:186315004-186315026 AAAATTATAAAACAATTAGCTGG + Intronic
918860404 1:189818664-189818686 AAAATTATACATCACAAATATGG - Intergenic
919049451 1:192495408-192495430 AATACTATAAAATACATTTCAGG + Intergenic
919060528 1:192626638-192626660 AAAATAATAAAAGACATACAGGG + Intergenic
919061220 1:192635377-192635399 AAAATTATAAAAGACAAGTAAGG + Intergenic
919210539 1:194477326-194477348 AAAATTATAAGACAGAAACCAGG + Intergenic
919251973 1:195067433-195067455 AAAATTATAAAAAAATTAGCCGG + Intergenic
919661740 1:200254391-200254413 AACACTATGAATCACATATCTGG + Intergenic
920015240 1:202902128-202902150 ACATTTATAAAACACAAATGGGG + Intronic
920019446 1:202943628-202943650 AAAGTTCTGAAACACAAATCAGG + Intronic
920468727 1:206207612-206207634 AAAAAAAAAAAAGACATATCTGG - Intronic
920595160 1:207261756-207261778 AAAATTACAAAACACATTGATGG + Intergenic
920832418 1:209477557-209477579 AAAATAATAAAACAAAAATTTGG - Intergenic
920874293 1:209819827-209819849 AAAATTATCCAACATTTATCTGG + Intergenic
921138050 1:212280161-212280183 AAATTTGCAAACCACATATCTGG - Intergenic
921422599 1:214965760-214965782 ATACTTGCAAAACACATATCTGG - Intergenic
921618681 1:217302042-217302064 TAAATTATAAAATACATCTTAGG - Intergenic
921665405 1:217864330-217864352 TAAATAATAAAACACATATAAGG + Intronic
921789548 1:219274058-219274080 AACTTTATAAAACACATACAGGG - Intergenic
922195431 1:223355573-223355595 ACATTTATAAAATACATATGTGG - Intronic
922692660 1:227707413-227707435 AAAAATATAAAAAAAATAGCTGG + Intergenic
923283887 1:232472112-232472134 AATTTTATAAATCACAAATCTGG + Intronic
923324328 1:232867654-232867676 AAAATTATTGAACACACATATGG - Intergenic
923426094 1:233871500-233871522 AACATTATGAAAGACATATGGGG - Intergenic
923736938 1:236618848-236618870 AAACTTAAAAAACACACATATGG - Intergenic
923886021 1:238157089-238157111 AAAATTATAATAAAGCTATCTGG - Intergenic
923933439 1:238730611-238730633 ATAATTCTGAAAAACATATCTGG + Intergenic
924299250 1:242620445-242620467 AACACTATAAAACATCTATCAGG - Intergenic
924395035 1:243609396-243609418 AAAATTATACACCACATACAGGG + Intronic
1063895168 10:10672394-10672416 AAAATTATAAAACTCCTAGAAGG - Intergenic
1064216888 10:13407980-13408002 AAAAATACAAAACAAATTTCCGG + Intergenic
1064586944 10:16848861-16848883 AAAAATACAAAACAATTATCTGG - Intronic
1064666944 10:17663211-17663233 AAAATAATAATAAACATTTCTGG - Intronic
1065235312 10:23644701-23644723 AATATTATAAAATACCTAACAGG - Intergenic
1065494533 10:26315083-26315105 AAAATTAAAAAAAAAATAGCTGG - Intergenic
1066337570 10:34494748-34494770 ACAATTATTAAAAAAATATCAGG - Intronic
1066695958 10:38077735-38077757 AAAAATATAAAAAAAATAGCTGG - Intergenic
1067550698 10:47233613-47233635 AAAAGTAAAAATCACATATGAGG - Intergenic
1068019471 10:51562928-51562950 AAAATAATAAAAAAAATAGCTGG - Intronic
1068069448 10:52178324-52178346 AAAATTATAAATCAATTAACAGG - Intronic
1068153056 10:53158850-53158872 AAATTTATAAAGCACTGATCTGG + Intergenic
1068223997 10:54082837-54082859 ATACTTACAAATCACATATCTGG + Intronic
1068266774 10:54659757-54659779 AAAAAAAAAAAATACATATCAGG + Intronic
1068278538 10:54835762-54835784 AAAATTTAAAATCACATAGCAGG + Intronic
1068375463 10:56173433-56173455 ATAAATATGAAACACATTTCAGG + Intergenic
1069159083 10:65069551-65069573 AAAATAATAAAACACAGAAATGG - Intergenic
1069167345 10:65178488-65178510 AAAATTATAAAATCCATATATGG - Intergenic
1069523611 10:69147317-69147339 ATATTTGCAAAACACATATCTGG - Intronic
1069803403 10:71098800-71098822 AAAATTATAAAACTCTTAAAAGG + Intergenic
1069851905 10:71411357-71411379 AAAAACATAAAACACATAGAAGG - Intronic
1070079624 10:73172766-73172788 AAAATTTTAAATTACATATGTGG - Intronic
1070123641 10:73602389-73602411 AAAATTATAAAAAAATTAGCCGG + Intronic
1070221583 10:74452777-74452799 CAAGTAATAAAACACATTTCTGG + Intronic
1070324229 10:75377426-75377448 AATTTTATAAAACACAGACCTGG + Intergenic
1070667469 10:78355518-78355540 AAAATTAAAAAAAAGATAGCGGG + Intergenic
1071389793 10:85161108-85161130 AAAATTATATAAAATATATATGG - Intergenic
1071692149 10:87832230-87832252 AAAATTAAAAAAGAATTATCAGG + Intronic
1072051469 10:91708123-91708145 AAAATGATAAAATACATAAAAGG - Intergenic
1072073685 10:91946802-91946824 AAATGCATAAATCACATATCTGG - Intronic
1072317833 10:94221004-94221026 AAAATTGTAAATCACCTCTCTGG - Intronic
1072530821 10:96317172-96317194 AAAACTAGAAATAACATATCTGG + Intronic
1072802053 10:98398977-98398999 AAAATTAAAAATAACATAGCCGG + Intronic
1073028535 10:100506479-100506501 AAATGTATAAAAGACATATAAGG - Intronic
1073235202 10:102008712-102008734 AAAATTAAAAAAAAAATAGCTGG - Intronic
1073271748 10:102270571-102270593 AAAATGATAATACACATATACGG - Intronic
1073765163 10:106674165-106674187 AAAATTATAAAAAAATTACCCGG + Intronic
1073805879 10:107097251-107097273 GAAATTAAAAAACACATTTTTGG + Intronic
1074023085 10:109605252-109605274 AAAATTGTAAAATAAATATGTGG - Intergenic
1074039473 10:109773894-109773916 AAAATTAAAAAACAGAAATAAGG - Intergenic
1074177523 10:111024406-111024428 CAAAATATAAAACACACATGAGG + Intergenic
1074224570 10:111471886-111471908 AAAATTATTAAAAACAAATCAGG - Intergenic
1074587763 10:114784929-114784951 AAAATTAGAAAACACAGAAAAGG - Intergenic
1074598924 10:114893934-114893956 AAAATTTTAAAAAATATATCTGG + Intronic
1074644575 10:115432040-115432062 AAAATTTTAAATTACATATGAGG - Intronic
1074730429 10:116367526-116367548 AAAAGTACAAAAAACTTATCTGG + Intronic
1074964049 10:118473207-118473229 AAAATGACTAAACTCATATCAGG + Intergenic
1075014525 10:118900485-118900507 AACATTAAAAAACACTTAGCTGG - Intergenic
1076031725 10:127164724-127164746 AAAATCATAACATAAATATCAGG + Intronic
1077263031 11:1633259-1633281 AATAGTATAAAGCACATCTCTGG - Intergenic
1077987809 11:7372809-7372831 AAAATAATAAAACACGTAAAAGG - Intronic
1078125389 11:8556796-8556818 AAAATGATGTAACACATATTAGG + Intronic
1078378720 11:10819900-10819922 AAAAATATAAAACAATTAGCTGG - Intronic
1078589608 11:12627915-12627937 CAGATTATAAAATACATATGAGG + Intergenic
1078641420 11:13100469-13100491 AAAATTAAAAATTACATATGTGG + Intergenic
1078769401 11:14334020-14334042 AAAATTAGAAATCACCTATGTGG - Intronic
1078960795 11:16267107-16267129 AAAACTATACAACACTTGTCTGG + Intronic
1079475004 11:20820867-20820889 AAGTTTATAAAACATAAATCAGG - Intronic
1079513864 11:21243676-21243698 AAAATTTTAAATCACATATGTGG - Intronic
1079565085 11:21872553-21872575 AATATTATTTAACACATTTCTGG + Intergenic
1080286257 11:30616678-30616700 AAAATTAAATAACACAGATAAGG + Intergenic
1080598162 11:33794494-33794516 AAAATTATAAAACCAATAAAAGG + Intergenic
1081083393 11:38770221-38770243 TAACTTGGAAAACACATATCAGG + Intergenic
1081300797 11:41448756-41448778 AAAATTATATAGCAAATGTCAGG - Intronic
1081562757 11:44233717-44233739 AAAATAAAAAAACCCATTTCTGG - Intronic
1081680562 11:44999545-44999567 AAAATTAAAAAAAAAATAGCTGG - Intergenic
1081988342 11:47323910-47323932 AAAATTCCAAAACACACATCTGG + Intronic
1082220369 11:49627988-49628010 AAAAATATAAAAAAAATAGCTGG - Intergenic
1082802277 11:57424023-57424045 AAAAATCTGAAACACATAACAGG + Exonic
1082929452 11:58585328-58585350 AAAACTATAATACATACATCTGG - Intronic
1083096669 11:60257984-60258006 AAAGTTATAAAACACAAAGAAGG - Intergenic
1084305098 11:68277282-68277304 AACATTATAAGAGACATGTCAGG - Intergenic
1084730398 11:71069583-71069605 AAAAATAGAAAACAAATATATGG - Intronic
1084893514 11:72249439-72249461 AAAATTTTAAAATATATCTCTGG + Intergenic
1085453333 11:76651452-76651474 CAAAATAAAAAACACATCTCAGG + Intergenic
1085540763 11:77267722-77267744 ATATTTGTAAAACACATGTCTGG - Intronic
1085544789 11:77307730-77307752 AAAATTATAAGAAACATAGAAGG + Intergenic
1085843830 11:80043314-80043336 AAAAATATAAAACAATTAGCTGG - Intergenic
1085933034 11:81108642-81108664 AAAATTAAAAAAAAAATATATGG + Intergenic
1086895440 11:92306950-92306972 AAAATTAAAAAAAAAATAGCCGG - Intergenic
1086919427 11:92569409-92569431 CAAAGTATAAATGACATATCAGG + Intronic
1086972400 11:93097729-93097751 TAAATTATAAAATACATTTTGGG - Intergenic
1087497774 11:98911545-98911567 AAAATTATAAAAGAAATCTTTGG - Intergenic
1087513064 11:99122661-99122683 AAAATAATAATAAACCTATCAGG - Intronic
1087542411 11:99536818-99536840 AAAATTTAAAATTACATATCTGG - Intronic
1087697806 11:101400741-101400763 AAAATTATAAAGTATATATTTGG - Intergenic
1087791606 11:102411685-102411707 AAAAAAAAAAAACACACATCTGG + Intronic
1087910573 11:103749096-103749118 TAAATTATATAACACATGTTTGG - Intergenic
1088051720 11:105524131-105524153 ATAATTATAAGACACATCTCAGG + Intergenic
1088054656 11:105560297-105560319 AAAAATATAAAACAATTAGCTGG + Intergenic
1088077064 11:105863025-105863047 AAAATTATATTACCCATGTCTGG - Intronic
1088560375 11:111109359-111109381 ACAATTTTAAAATACATATGTGG + Intergenic
1088839630 11:113613951-113613973 AAAATTTTAAATGACATATGTGG + Intergenic
1089355323 11:117847140-117847162 AAAATTAGAAAACACATACAAGG - Intronic
1089855529 11:121541033-121541055 AAAATTTTGAAACAGATATTTGG - Intronic
1090334304 11:125952307-125952329 AATATTTTAAATCACATATATGG - Intergenic
1090360416 11:126168620-126168642 AAAATTACAAAAAAATTATCTGG - Intergenic
1090725472 11:129522091-129522113 AAAACAATTAAACACATATCTGG - Intergenic
1091043783 11:132307404-132307426 AAAATTATTAATCACTTATTGGG + Intronic
1091271715 11:134318389-134318411 AACATTATATATCACATAACAGG + Intronic
1092318925 12:7450462-7450484 AAAATTTTAAAAAATATTTCTGG - Intronic
1092448211 12:8577684-8577706 AAAAACAGAAAACACATATAGGG + Intergenic
1092593208 12:9970605-9970627 AAACTAATAAGACACAAATCTGG + Intronic
1093028389 12:14265607-14265629 AAAATTATTTAAAACGTATCTGG - Intergenic
1093089256 12:14903423-14903445 AAAAACATATAACACATATTGGG - Intronic
1093350062 12:18088393-18088415 AAAATTCTAAAACACATGCTGGG - Intronic
1093364559 12:18276695-18276717 AAAACTATAAAATACAGCTCTGG - Intronic
1093547527 12:20366756-20366778 AAAATAATAAACCAAAAATCTGG - Intergenic
1093634788 12:21452434-21452456 ATACTTATAAAACACATTTATGG - Intronic
1093675418 12:21933675-21933697 AAAAATATAAAGCACATTTATGG + Intronic
1093999630 12:25680981-25681003 AAAAAAATAAAAACCATATCAGG + Intergenic
1094044250 12:26149848-26149870 AAAATTAAAAAAAAAATTTCAGG - Intronic
1094301920 12:28974097-28974119 AAAATTATACAGCAAAAATCTGG - Intergenic
1095148249 12:38757461-38757483 TAAATTATAAAATTAATATCTGG + Intronic
1095202191 12:39397346-39397368 AATATAGTGAAACACATATCAGG + Intronic
1095236989 12:39809016-39809038 AAAATCATAAAACATTTATAAGG - Intronic
1095557798 12:43528363-43528385 AAAAAAAAAAAACACAAATCCGG + Intronic
1095587848 12:43868238-43868260 GAAATTAAAAAACACACTTCAGG + Intronic
1095611471 12:44133624-44133646 AAAATTATGAAACAAATTTATGG + Intronic
1095654559 12:44653866-44653888 AAAATTCTAAGACACATTTATGG - Intronic
1095771698 12:45967075-45967097 TAAATTATAAATTATATATCAGG - Intronic
1096692772 12:53331308-53331330 AAAAATATAAAAAAATTATCTGG + Intronic
1096829847 12:54305491-54305513 AAAATTAAAAAAAAAATAGCCGG + Intronic
1096934184 12:55252982-55253004 AAAAATGTAAAATACATCTCAGG + Intergenic
1096945723 12:55407379-55407401 ACAATTATAAATCCTATATCTGG - Intergenic
1097501219 12:60405868-60405890 AAAAATATAAAACATTTTTCAGG + Intergenic
1097615225 12:61876967-61876989 ACAACTATCAAACACATATAAGG - Intronic
1097751885 12:63364417-63364439 AAAATTGTAAGACCCATATATGG - Intergenic
1097760147 12:63455115-63455137 ATAATTATAACAGTCATATCGGG + Intergenic
1098027002 12:66214377-66214399 AAAATTAAAAAAAAAATAGCTGG + Intronic
1098043710 12:66378780-66378802 AAAATTAAAAAACAAAAATTAGG + Intronic
1098296685 12:69011211-69011233 CGAATTATAAGACACATAGCTGG - Intergenic
1098389781 12:69957367-69957389 AAAATTATAAAAAATACATATGG + Intronic
1098655595 12:73025461-73025483 AAAATAAGAAAATACAGATCAGG + Intergenic
1098853582 12:75626640-75626662 AAAATTATAATATTCATATGTGG + Intergenic
1099415102 12:82374729-82374751 AAAATTATAAAGCATATTTCAGG + Intronic
1099506337 12:83481062-83481084 GTAATTATAAAAGACATATCTGG - Intergenic
1099632850 12:85172946-85172968 AAAATTAAAAAAAAAATAGCTGG + Intronic
1099768066 12:87015950-87015972 ATTAGTATAAAACACATATAAGG - Intergenic
1099793495 12:87365207-87365229 AAAATCTCAAACCACATATCAGG + Intergenic
1099864798 12:88266231-88266253 AAAATTATAAAATTCCTATAAGG - Intergenic
1100307747 12:93366817-93366839 AAAATTAAAAAATCCAAATCTGG - Intergenic
1100626050 12:96333510-96333532 AAAATAATAAAAAACTTAGCTGG + Intronic
1100775757 12:97972118-97972140 AAAATTAAGAACCAGATATCAGG - Intergenic
1101081586 12:101191798-101191820 AAAAGTATGAAACACAAATAAGG + Intronic
1101470583 12:104993098-104993120 AAAATAATAATACAGCTATCAGG - Intronic
1101590974 12:106125053-106125075 TAAATTTTAAAACAAAAATCTGG + Intronic
1101733679 12:107446923-107446945 AAAATTATAACATTCTTATCTGG - Intronic
1101742939 12:107515240-107515262 AACATTTTAAAACAAAGATCTGG + Intronic
1101781483 12:107842618-107842640 AAAATTAATAAACACATAAAGGG + Intergenic
1102373804 12:112404622-112404644 AAAATTAAAATGCACAAATCTGG + Intergenic
1102840546 12:116116031-116116053 AATATTGTGAAACACATATTTGG + Intronic
1102992410 12:117324568-117324590 AAAAATATAAAACAATTAGCTGG + Intronic
1103106101 12:118226824-118226846 AAAATCAGAAAGCACATATAAGG + Intronic
1103266885 12:119638299-119638321 AAAATTTAAAAAAATATATCTGG + Intronic
1103307657 12:119978586-119978608 AAAATTTTAGAAAACATATCAGG - Intergenic
1103788760 12:123454160-123454182 ATAATAATAAAATAAATATCAGG - Intergenic
1103810923 12:123613130-123613152 AAACTAATAAAAAACATATTTGG - Intronic
1103837680 12:123836719-123836741 AGAATTGTACAACACATATCAGG + Intronic
1104322979 12:127769639-127769661 AAAAATATAACACACATTCCAGG + Intergenic
1105211985 13:18262300-18262322 AAAATAATAAAATAAAAATCAGG - Intergenic
1105358075 13:19678410-19678432 CATATTATAAAACATATATAAGG - Intronic
1105512727 13:21064246-21064268 AAAATTAAAAAACCCATGTTTGG + Intergenic
1105628081 13:22133341-22133363 AAAAATAGAAAAAACATAACTGG - Intergenic
1106497128 13:30289459-30289481 AAAATTAGAAAATAAAAATCAGG - Intronic
1106533261 13:30615399-30615421 ACCATTATATAACACATACCAGG + Intronic
1106654954 13:31733315-31733337 AGGATTATAAAACACAGACCTGG - Intergenic
1107077709 13:36341282-36341304 AAAAGTATAAATTACATATGTGG - Intronic
1107371585 13:39756203-39756225 AAAATTATGAAAAACTTATTTGG + Intronic
1107572896 13:41682014-41682036 AATATTTTAAAACACAACTCAGG - Intronic
1107665318 13:42682862-42682884 CAAATATTAAAACACATATCTGG + Intergenic
1107685511 13:42893704-42893726 AAACTTAGAAAGCACCTATCTGG - Intronic
1107704506 13:43087018-43087040 CAAATAATAAAACTCATATTTGG - Intronic
1108020051 13:46118947-46118969 ATAATTGCAAAACACATATCAGG + Intergenic
1108488262 13:50950815-50950837 AAAATAAGAAAACAGAAATCAGG - Intronic
1108709525 13:53018791-53018813 AAAATTTAAAATCACATATAAGG + Intergenic
1108731595 13:53241026-53241048 TATATTATACAGCACATATCAGG - Intergenic
1108923684 13:55709795-55709817 AAAATTATAAAACAAAACTGAGG + Intergenic
1109153686 13:58877105-58877127 AATATTATAAAACACATCAGTGG - Intergenic
1109400811 13:61825915-61825937 ATAATTGTAAATCACATATCTGG - Intergenic
1109466492 13:62740121-62740143 GAAATCATATAAAACATATCAGG - Intergenic
1110053420 13:70934480-70934502 AAATTTAAAAATCACATCTCTGG - Intergenic
1110325500 13:74210071-74210093 AATATTATAAAACAGATACCTGG + Intergenic
1110406950 13:75161327-75161349 AAAAATAGAAAACATATGTCAGG - Intergenic
1110517433 13:76431492-76431514 GAAATCATAAAATACATATCAGG - Intergenic
1110534327 13:76633558-76633580 TAAAAAATAAAGCACATATCTGG - Intergenic
1110574403 13:77039321-77039343 AAAAATGTAAAATACATATGTGG - Intergenic
1110588500 13:77224058-77224080 AAAATTTCAAAACAGACATCAGG + Intronic
1110632811 13:77729204-77729226 AAATTTGGCAAACACATATCAGG - Intronic
1110786657 13:79536720-79536742 AATATTATAAAAGACATCTTTGG + Intronic
1110958188 13:81583488-81583510 AAAGTAATAGAACACATAACTGG - Intergenic
1111028145 13:82561536-82561558 AAAATTATAAATCTATTATCTGG - Intergenic
1111095410 13:83507589-83507611 AAAGATATAAATGACATATCTGG + Intergenic
1111293841 13:86255165-86255187 ATAATTATAAAATAAATATTGGG - Intergenic
1111402102 13:87751877-87751899 AAAAAAATAAAACTCAAATCTGG - Intergenic
1111435906 13:88207781-88207803 AAAAATAGAAAACAGATATTTGG + Intergenic
1111449889 13:88401240-88401262 AAAATTATAAGACAACTATATGG + Intergenic
1111759483 13:92443603-92443625 AAATAAATAAAACACATATGTGG + Intronic
1111817592 13:93173162-93173184 AAAATTATAACACACAGACTAGG + Intergenic
1111910511 13:94306044-94306066 AAAATTTTAATACACGTTTCAGG + Exonic
1112192310 13:97189978-97190000 TGAATGATAAAAAACATATCAGG - Intergenic
1112375327 13:98834784-98834806 AAAATTACCAAACACTTAGCAGG - Intronic
1112749153 13:102564598-102564620 AAAATTGTAATAAACACATCAGG + Intergenic
1112811939 13:103228494-103228516 AAAATTATACAACATGTATTAGG - Intergenic
1112935238 13:104789144-104789166 AAAAATACAAAACAATTATCCGG - Intergenic
1113410569 13:110084275-110084297 AAAAATATAAAAAAAATAGCTGG + Intergenic
1113486719 13:110658601-110658623 AAAAGTATAAAACACATTTTGGG + Intronic
1113993966 14:16052149-16052171 AAATTTATAAAAAACGTAGCTGG - Intergenic
1114386031 14:22255968-22255990 AAATTCATAAAACACACATAGGG - Intergenic
1114698495 14:24651196-24651218 AAAATAATAAAAGCCATATATGG + Intergenic
1114765319 14:25364282-25364304 AACAGTATAAAATACATATGAGG + Intergenic
1114948684 14:27718728-27718750 AAAAATTTAAAACGCATACCAGG + Intergenic
1115178972 14:30599800-30599822 AAAATTTTAAATTACATATATGG + Intronic
1115327379 14:32155412-32155434 GAAATTATAAAATACTTAACTGG - Exonic
1115563819 14:34607257-34607279 ACAATTTAAAAAAACATATCAGG + Intronic
1115563821 14:34607303-34607325 ACAATTTAAAAAAACATATCAGG + Intronic
1116006165 14:39294180-39294202 AAAAAAAAAAAATACATATCTGG - Intronic
1116048391 14:39773432-39773454 AAAAATACCAAACACACATCTGG - Intergenic
1116053401 14:39833115-39833137 AAAGTTATAAAGCAGATATATGG + Intergenic
1116369006 14:44106317-44106339 AAAATTACAAATCACAAATTTGG + Intergenic
1116675100 14:47896365-47896387 AAAAATATAAAACAGATAAAAGG - Intergenic
1116745952 14:48818881-48818903 GAAAATACAAAACAAATATCAGG + Intergenic
1117133530 14:52709712-52709734 CAAAATCTAAAACACATTTCTGG - Intronic
1117309375 14:54506713-54506735 AAAATTAAAAAACAAATAGGTGG + Intergenic
1117390972 14:55262336-55262358 AAAAATATAAAATATATATCAGG + Intergenic
1117553186 14:56856623-56856645 AAATTAATAAATCACATATAAGG - Intergenic
1117863266 14:60115825-60115847 AATACTATTAAACACATATTAGG - Intronic
1117901397 14:60537435-60537457 AAAATTTTAAATTACATATGAGG + Intergenic
1117994378 14:61465133-61465155 ATATTTGTAAAACACATATCTGG - Intronic
1118226988 14:63910928-63910950 AAAATTGTAAACCAGATGTCTGG + Intronic
1118997140 14:70846872-70846894 AAAATAATAAAAAGCATATATGG - Intergenic
1119131724 14:72179061-72179083 AAAATCATGAAACAGAAATCTGG + Intronic
1119294914 14:73525191-73525213 AAAAATAAAAAACAGATAGCTGG - Intronic
1119682220 14:76601365-76601387 AAAATTGTAAAAAAAAAATCAGG + Intergenic
1120274632 14:82356027-82356049 AAAGTTATCAAACAGATATTAGG - Intergenic
1120374742 14:83689227-83689249 AGAATTATAAAACACTTAGGAGG - Intergenic
1120379043 14:83749667-83749689 ACATTTGTAAACCACATATCTGG - Intergenic
1120391746 14:83917500-83917522 AAAATTAAAAAACGGGTATCTGG - Intergenic
1120402356 14:84048054-84048076 AAAATTAAAAAAAAAATTTCTGG - Intergenic
1120422483 14:84305449-84305471 AAAAATATAAAACAAATACATGG + Intergenic
1120475323 14:84979609-84979631 AAAATTATTAAAAACACATAAGG - Intergenic
1120556690 14:85936797-85936819 ATATTTGTGAAACACATATCTGG - Intergenic
1122361215 14:101166462-101166484 AAAAATAAAAACCACATATTTGG - Intergenic
1202904815 14_GL000194v1_random:63116-63138 AAAATAAAAAAACACAAAACTGG - Intergenic
1123954263 15:25317785-25317807 AAAAATATAAATGATATATCTGG - Intergenic
1124010795 15:25836953-25836975 AAAATTATTATATACATATAAGG + Intronic
1125014182 15:34914838-34914860 TAAAATATAAACCACATATCTGG - Intronic
1125021456 15:34990606-34990628 AAAAGAAGAAAAGACATATCAGG + Intergenic
1125126873 15:36234430-36234452 AACATTGCAAAACACATATCTGG + Intergenic
1125140839 15:36405467-36405489 AAAATTCAAAAACACAACTCTGG - Intergenic
1125295737 15:38201218-38201240 AAAATTAACAAACAGATCTCAGG + Intergenic
1125301699 15:38261494-38261516 AAAATTATTAAACTGATATTAGG - Intronic
1125337612 15:38642592-38642614 AAAAATATAAAAAAAATAGCCGG - Intergenic
1125527421 15:40386077-40386099 AAAATTTTAAAACATATTTGAGG + Intronic
1125888997 15:43251835-43251857 AAAACTAAAAAATACATATGTGG - Intronic
1126248187 15:46536126-46536148 AAAATTATAAAACTCATAGAAGG - Intergenic
1126254481 15:46609085-46609107 AAATTTAGAAAACAGATATTTGG + Intergenic
1126266545 15:46761353-46761375 AAAAGTATAAGACACATTCCGGG + Intergenic
1126398925 15:48249130-48249152 AAAATCAGAGAACACATATTGGG + Intronic
1126400626 15:48265836-48265858 AAAATTTTAAATTACATATATGG - Intronic
1126831088 15:52606369-52606391 AAAATTATAAAAGACTATTCTGG + Intronic
1127037829 15:54938528-54938550 AAAATCATAAAACAAATTTTGGG - Intergenic
1127313657 15:57774675-57774697 TAAATTCTAAAACACAAACCTGG + Intronic
1128198525 15:65783104-65783126 AAAATTAAAATACAGATGTCAGG + Intronic
1128542970 15:68549777-68549799 AAAAATACAAAACAACTATCTGG + Intergenic
1128909356 15:71498361-71498383 AATATTTTAAAACACATTTCAGG - Intronic
1128962629 15:72023531-72023553 AAAATTACAAAAAAAATAGCTGG + Intronic
1130631806 15:85576963-85576985 AACATTATAAAACAGAAATCTGG - Intronic
1130842907 15:87718328-87718350 AAAATTTTAAATTACATATGTGG - Intergenic
1131009758 15:89007336-89007358 AAAATTTTAAAATACATCTGTGG + Intergenic
1131090387 15:89620506-89620528 TAAATATAAAAACACATATCTGG - Intronic
1131498709 15:92938613-92938635 AAAATTCTAAAAGACAGAACTGG - Intronic
1131525807 15:93151536-93151558 AAAATTATAAAAAAATTATTTGG - Intergenic
1131586316 15:93697488-93697510 AAAAATATACTACACATATTGGG + Intergenic
1131632281 15:94190988-94191010 AAATTAATAAAACAAATATCTGG + Intergenic
1131697886 15:94899794-94899816 TAAAATATAAAACAAAGATCCGG - Intergenic
1131715792 15:95109608-95109630 AAAATTTTAAATCACATATGTGG + Intergenic
1131761298 15:95625638-95625660 AAAATGAAAAAACACAAATAAGG - Intergenic
1131857044 15:96608442-96608464 AAAATTATAAGGCACATTTTGGG - Intergenic
1132205346 15:99982654-99982676 AGATCTATAAAAAACATATCTGG + Intronic
1132230292 15:100177410-100177432 AAAATTAAATAACACATTTCTGG - Intronic
1132280433 15:100609438-100609460 AAAATAATAAATCACATATTTGG - Intronic
1132330093 15:101006517-101006539 ATAGTTATAAACCACATTTCTGG + Intronic
1133132550 16:3686474-3686496 AAAATTTTAAAACAATTAGCTGG - Intronic
1133273351 16:4622283-4622305 ATAATTAAAAAACAATTATCTGG - Intronic
1133273403 16:4622595-4622617 ATAATTAAAAAACAATTATCTGG - Intronic
1133310614 16:4843950-4843972 AAAAATATAAAACAATTAGCCGG + Intronic
1133820674 16:9233629-9233651 AAAAATATAAAATACAGATATGG + Intergenic
1133883281 16:9803243-9803265 AAAATTACAAAAAAAATAGCTGG + Intronic
1134142563 16:11733832-11733854 AAAATTAAAAAAGAAAGATCTGG - Intronic
1134773062 16:16827684-16827706 AAAATAAAAAAACACCTAGCTGG - Intergenic
1134793250 16:17010406-17010428 AAAATTTTAAATTACATATGTGG - Intergenic
1135072519 16:19364518-19364540 AAAATTGTAAAACACTTGACTGG + Intergenic
1135124904 16:19800568-19800590 ATAATTATAAAATAAATATTGGG + Intronic
1135565332 16:23507333-23507355 ATAATAATAAAACACAAATTAGG + Intronic
1135573232 16:23565477-23565499 AAAAATATACAACAGATTTCTGG - Intronic
1135879975 16:26245919-26245941 AAAATTATAAAACTTATTCCTGG + Intergenic
1136126728 16:28188518-28188540 AAAAGTATGCAAAACATATCCGG + Intronic
1136267138 16:29128405-29128427 AAAATCATAAACCTCATCTCAGG - Intergenic
1137064235 16:35822002-35822024 AAAATTGCAAATGACATATCTGG - Intergenic
1137637357 16:49998492-49998514 AAAATTTTAAAATACTTGTCCGG + Intergenic
1137648247 16:50094790-50094812 AAAATTTTAAAACTCTTACCTGG - Exonic
1137656886 16:50167604-50167626 AAAACTATAAAACTCATAGAAGG - Intronic
1138161846 16:54761860-54761882 TGAATTATAAAACACATTTCTGG - Intergenic
1138191077 16:55014751-55014773 AAAATAAAAAAATACATAACCGG + Intergenic
1138818128 16:60226388-60226410 AAAATTACAAAAAAATTATCTGG - Intergenic
1138919260 16:61507077-61507099 CAGATTATAAAATACATATTTGG - Intergenic
1139621096 16:68143551-68143573 TTAATTATAAAACACAGGTCAGG + Intronic
1140406608 16:74715706-74715728 AAAATTTAAAATCACATATGTGG + Intronic
1141434592 16:83992719-83992741 AAAATTAAAATACACATTCCTGG + Intronic
1142070430 16:88088728-88088750 AAAATGATAAACCTCATCTCAGG - Intronic
1142219193 16:88845014-88845036 AAAATTATAAAACCCATGCCTGG + Intronic
1142830215 17:2543305-2543327 AAAATTTTAAAGAAAATATCCGG - Intergenic
1142921455 17:3190707-3190729 AAAGATATATAACACATTTCTGG + Intergenic
1143925399 17:10365032-10365054 AAAAATATAAAAAAAATAGCTGG - Intronic
1143950354 17:10627682-10627704 AAAAATATAAAACAAATACAAGG - Intergenic
1144082492 17:11777071-11777093 ATATTTATAAAACAGATATCAGG - Intronic
1144478634 17:15611008-15611030 AAAAAAAGAAAACACATTTCTGG - Intronic
1144518102 17:15933827-15933849 AAAATTAAAAAACAAATAAGAGG - Intergenic
1144525420 17:15985318-15985340 AAAATTATAGAAAACAACTCAGG + Intronic
1144610119 17:16704049-16704071 AACATTTTAAACCACATATGTGG + Intronic
1144902626 17:18611370-18611392 AACATTTTAAACCACATATGTGG - Intergenic
1144919663 17:18752721-18752743 AAAAAAAGAAAACACATTTCTGG + Intronic
1144928437 17:18834610-18834632 AACATTTTAAACCACATATGTGG + Intergenic
1148034081 17:44644935-44644957 AAAATTTTAAATTACATATATGG - Intergenic
1148589552 17:48805597-48805619 CAAATTATAAAATACATGTAAGG + Intronic
1149142008 17:53442425-53442447 AAAATTATAAAATTTATATATGG + Intergenic
1149460406 17:56825000-56825022 GAGTTTATAAAACACATATACGG - Intronic
1149550290 17:57534718-57534740 AAAAATATAAAACAAAAACCTGG + Intronic
1149572079 17:57679005-57679027 AAAAATATACAACAAATAACCGG - Intronic
1149904430 17:60512361-60512383 AAAATAATAAAACACCTCTTTGG - Intronic
1150325861 17:64256970-64256992 AAACTTATAAAATGCATATTGGG + Intronic
1150457540 17:65319311-65319333 AAAATGATAAAACTCAAAGCGGG + Intergenic
1150676848 17:67251443-67251465 ATATTTATAAATCATATATCTGG + Intergenic
1152081808 17:78192158-78192180 AAAAATACAAAACACTTAGCAGG - Intronic
1152832807 17:82509105-82509127 AAAAATATAAAACAATTAGCCGG + Intergenic
1153251105 18:3122806-3122828 AAAATTATCAAAAACATTTTTGG - Intronic
1153728288 18:7980371-7980393 AAAATAAAAAAAAAGATATCTGG - Intronic
1153965003 18:10171637-10171659 AAAAATAAAAAAAAAATATCTGG + Intergenic
1154467733 18:14666037-14666059 AAAAAAATATAACACATATTTGG - Intergenic
1155210963 18:23601657-23601679 ATAATAATAAAATACATATAAGG - Intronic
1155912610 18:31522007-31522029 AAAATTATAAATAAAATAACAGG + Intronic
1156004256 18:32421087-32421109 AATATTATACAACAGCTATCAGG - Intronic
1156121743 18:33851791-33851813 AAAATTATACAAATCATATCAGG + Exonic
1156138622 18:34077144-34077166 AAAAATACAAAACAAATAGCTGG + Intronic
1156564616 18:38172663-38172685 AAATTGATAAAATACATATATGG + Intergenic
1156597861 18:38568290-38568312 AAAATAATACAACACATCTTGGG + Intergenic
1156794789 18:41031038-41031060 TAACTGATAAAACACACATCCGG + Intergenic
1156829325 18:41471468-41471490 TATATTATAAAACAAATATTAGG - Intergenic
1157093605 18:44665377-44665399 AAAATCATAAAATCCCTATCTGG - Intergenic
1157129797 18:44996165-44996187 AAAAGTATAAAATACTTATGAGG + Intronic
1158101848 18:53838504-53838526 AAAAGTATAAAACTCATTTTAGG - Intergenic
1158160102 18:54471766-54471788 AAAATAAAAAAACAAATTTCTGG + Intergenic
1158768949 18:60491475-60491497 AAAATTACAAAAAAAATAGCCGG - Intergenic
1158848409 18:61469001-61469023 AAAATCCTAAAACACAAATGTGG + Intronic
1159424982 18:68273191-68273213 AAAACTATAAAACACAAAGTTGG - Intergenic
1159425281 18:68276676-68276698 AAAATAAGAAAAAAAATATCTGG - Intergenic
1159431102 18:68355098-68355120 ATAATCATAAAACAAATTTCAGG + Intergenic
1159448401 18:68568329-68568351 AAAACTTTAAAACACATCTAAGG + Intergenic
1159751602 18:72309402-72309424 AAAAATATATATTACATATCTGG - Intergenic
1159896232 18:73998992-73999014 AAAAGTATAAAATACAAATAAGG - Intergenic
1159970088 18:74639290-74639312 AAAATTGTAATACAAATATTGGG + Intronic
1160159672 18:76461629-76461651 AAAATCAGAAAACATACATCGGG + Intronic
1160664337 19:317092-317114 AAAATTAAAAAACAAACAACAGG + Intronic
1160998907 19:1898961-1898983 AAAACTATAAAACAATTAGCCGG + Intergenic
1161131765 19:2594209-2594231 AAAAATACAAAACACTTAGCTGG + Intronic
1161437996 19:4275261-4275283 AAAATTAAAAAACACAGGCCTGG + Intergenic
1162147825 19:8623951-8623973 AAAATAAATAAACACATATAGGG - Intergenic
1162202847 19:9033679-9033701 AAAGTTTTAAAACACATATATGG - Intergenic
1163383259 19:16982674-16982696 AAAATAATAAAAAAAATAGCTGG + Intronic
1163386528 19:17003360-17003382 AAAACTTTAAAACAATTATCTGG - Intronic
1164044860 19:21528406-21528428 AAAATTATAGAACACTTGACTGG + Intronic
1164271147 19:23673137-23673159 GAAATTAAAAAACTTATATCTGG - Intronic
1164627069 19:29736808-29736830 AAAATTAGAAGAGACAGATCAGG - Intergenic
1164759900 19:30720804-30720826 AAAAATATAAAAAACTTAGCTGG + Intergenic
1164977811 19:32587463-32587485 AAAAATTCAAAACACAGATCTGG - Intergenic
1165240938 19:34466757-34466779 AAAATTAGAATCCACATATTTGG + Intronic
1165452590 19:35893005-35893027 AAAAATATAAAACAATTAGCCGG + Intronic
1165799390 19:38538236-38538258 AAAAATATAAAAAAAATAGCAGG + Intronic
1165985406 19:39764559-39764581 AATAGTAAAAAACACATCTCTGG - Intergenic
1167174617 19:47857229-47857251 TAAATTATAAAACAAATAGATGG - Intergenic
1167313189 19:48749312-48749334 ATAATTAAAAAAAAAATATCCGG + Exonic
1167805041 19:51776321-51776343 AAAATTCTCAAAAACATATTAGG - Intronic
925219588 2:2127248-2127270 CTAATTCTAAAACACATATGGGG - Intronic
925583831 2:5442741-5442763 AAAATTAAAAAAAAAATAGCTGG - Intergenic
926469811 2:13239930-13239952 ACAATTATAAAACACCTGTGAGG - Intergenic
926514062 2:13818616-13818638 TGAATTCTAAAACAAATATCTGG + Intergenic
926931282 2:18043622-18043644 ATAATTATAAATCACATTCCTGG + Intronic
927071107 2:19530277-19530299 AAAAGTATTAATCAAATATCTGG + Intergenic
927092760 2:19724841-19724863 AAAATTTTAAATGACATATGTGG + Intergenic
927148610 2:20183031-20183053 ACATTTCTAAAACACATACCTGG - Intergenic
927745840 2:25620044-25620066 AAAATAATAAAAAAAAAATCTGG + Intronic
928068647 2:28192681-28192703 AAAATTACAAAAAAATTATCTGG - Intronic
928137115 2:28695967-28695989 AAAATTAAAAAACAACTATCTGG + Intergenic
928814302 2:35272855-35272877 AAAATAAAAAAACAGAAATCTGG - Intergenic
929380042 2:41338406-41338428 AAAATTAAAAATTACAAATCAGG - Intergenic
929696373 2:44119779-44119801 AAAATCATAAAAGAAACATCAGG + Intergenic
929702141 2:44172024-44172046 AAAATTAGCAAACAAATAACTGG + Intronic
930229588 2:48829283-48829305 CAACTTAGAAAACACATGTCAGG + Intergenic
930334262 2:50025637-50025659 TACATTTTAAAACACATTTCTGG + Intronic
930435745 2:51339691-51339713 AGAATCATAAAACAAATATGAGG - Intergenic
930758835 2:55008623-55008645 AAAATAATCAAACAAATCTCTGG + Intronic
931000764 2:57779641-57779663 AAAATTCTTAACCACATAACAGG - Intergenic
931045782 2:58351165-58351187 AAAAATATAAAACAATTAGCCGG + Intergenic
931424238 2:62156456-62156478 ATATTTTTAAAATACATATCTGG - Intergenic
931881175 2:66572853-66572875 AAAATTGTCAAATACATATATGG - Exonic
932065551 2:68555201-68555223 AAAATTATAGAAGACAAAACTGG + Intronic
932111515 2:69005938-69005960 AAAATTATAAAACAGAAGTATGG - Intergenic
932319843 2:70813836-70813858 AAAAATACAAAAAAAATATCCGG - Intronic
932542910 2:72675495-72675517 AAAATTAGAAAACACAGGCCAGG + Intronic
933382077 2:81561304-81561326 AAAATTACAAAACAATTAGCTGG + Intergenic
933413958 2:81960831-81960853 AGAAATATAATACAAATATCTGG + Intergenic
933429892 2:82162638-82162660 AAAATTAAGAAAAAAATATCTGG - Intergenic
933869707 2:86553697-86553719 AAAGTTATAAAAGACATACTGGG + Intronic
934501822 2:94867308-94867330 AAAATTAAAAAACACAAAACTGG + Intergenic
934669506 2:96201424-96201446 AAAATTACACAACAAATAGCTGG + Intronic
934718343 2:96555904-96555926 AAAAAAATTAAACACATCTCAGG - Intergenic
935122993 2:100198464-100198486 AAAATTATATAGCACAACTCAGG - Intergenic
935235204 2:101132566-101132588 AAAATTGTCAAACACAAAACAGG - Intronic
935274018 2:101460606-101460628 GAAATTACAAAACACAGAGCAGG + Intronic
935395095 2:102599347-102599369 AAAATTGCAATACACATATCTGG - Intergenic
936502546 2:113077701-113077723 AAAATTAAAAAAAACCTAGCTGG - Intergenic
936705967 2:115074171-115074193 AAAATTTTAAAAAAGTTATCTGG - Intronic
937142082 2:119610750-119610772 AAAATTTTAAAAGACTTATTTGG - Intronic
937443553 2:121937379-121937401 AAAATTTTAAATTACATATGTGG + Intergenic
937663965 2:124463276-124463298 AAAATTATAAAATATATGTTAGG + Intronic
937769181 2:125698794-125698816 AGAATAACAGAACACATATCAGG - Intergenic
937805820 2:126143954-126143976 AAAATTATAAAACACTAAGCAGG - Intergenic
938321182 2:130365676-130365698 AAAACTATAAAACACTTAGAAGG - Intronic
938507985 2:131906861-131906883 AAAATTATAAAACTCTTAGAAGG - Intergenic
938537712 2:132258722-132258744 AAATTTATAAAAAACATAGCTGG + Intergenic
939027203 2:137028288-137028310 AAAATTATATAACAAATGGCAGG + Intronic
939117714 2:138079782-138079804 AATATTGTAAAACATATATTTGG + Intergenic
939658905 2:144862764-144862786 AAAATAATTAAAAACATCTCTGG + Intergenic
939951591 2:148481513-148481535 AAAAATACTAAACACATATATGG - Intronic
939979723 2:148765544-148765566 AAAGTTATAAAACACAATGCTGG - Intronic
940137142 2:150450503-150450525 AAAATTATGAAACAGAAAACTGG - Intergenic
940389850 2:153119561-153119583 AGATGTATAAAATACATATCTGG - Intergenic
940572896 2:155463957-155463979 AAAATTATAAAACAAAAAAAAGG - Intergenic
940992271 2:160110029-160110051 AAAATTTTAAATTACATATAGGG + Intronic
941059018 2:160824936-160824958 AAAAGTATAAAACACAGTTAAGG - Intergenic
941339916 2:164294259-164294281 GAAATTATGAAACACATAAATGG + Intergenic
941360330 2:164543137-164543159 AAAATTAAAAAAAAAATAGCTGG + Intronic
941685713 2:168446258-168446280 AATATTGGAACACACATATCAGG + Intergenic
942220651 2:173765842-173765864 AAAAAAATACAAAACATATCTGG + Intergenic
942260092 2:174151359-174151381 AAAATTATTACACAAATATATGG + Intronic
942403387 2:175627320-175627342 AAAATTTTTAAACACTTCTCAGG + Intergenic
942422108 2:175818967-175818989 AAAATTATGAAACACATAAGAGG - Intergenic
942469107 2:176241563-176241585 AAATTTTTATAACAAATATCAGG - Intergenic
942779319 2:179622575-179622597 AAGATTCTAAAATACATAGCTGG - Intronic
942977676 2:182038443-182038465 AAAAATATCAAACAAATATAAGG - Intronic
943054477 2:182959052-182959074 AAAATTTTAAATTACATATGTGG + Intronic
943250460 2:185515498-185515520 AATTTTATAAAACATATATGTGG - Intergenic
943346404 2:186743135-186743157 AAAATTAGAGAAAATATATCAGG + Intronic
943357025 2:186868978-186869000 AAAATTATAAAACATCTAGATGG + Intergenic
943832590 2:192481695-192481717 AAAATTAAAAAATCCATACCTGG - Intergenic
944223882 2:197330168-197330190 AAATTTATACAAAACCTATCTGG + Intergenic
944242875 2:197502229-197502251 AAAATTGCAAAAGAAATATCAGG - Intronic
944284144 2:197929285-197929307 AAATGTATAAAACCCAAATCAGG - Intronic
944460351 2:199942598-199942620 AAAGTTATAAAACAGTTCTCAGG + Intronic
944499293 2:200341849-200341871 AAAAATACAAAAAAAATATCTGG - Intronic
944917242 2:204373614-204373636 ACATTTATTAAACACATACCTGG - Intergenic
944921908 2:204423369-204423391 CAACTTAGAAAACACATTTCAGG + Intergenic
945098759 2:206244198-206244220 AAAATAATAAAACACAAAGTTGG + Intergenic
945299224 2:208200297-208200319 AAAAAAAAAAAACACATATCTGG - Intergenic
945437943 2:209840871-209840893 AAAATTATAATGCAGATATAGGG + Intronic
945645105 2:212482463-212482485 AAAATAATAAAATTCATCTCAGG - Intronic
945706744 2:213244192-213244214 AATATGATAAAACACATAATGGG - Intergenic
945753441 2:213817047-213817069 AAACTTATAAAACAGATAAAAGG + Intronic
946499015 2:220225916-220225938 AAAATAATAAAATAGATAACAGG - Intergenic
946892280 2:224290015-224290037 AAAAACATAAAACACATCTAGGG - Intergenic
947007898 2:225533525-225533547 AAAAATACAAAACAAATAGCTGG + Intronic
947127394 2:226884080-226884102 AAGATGATAAATCACATCTCTGG + Intronic
947193378 2:227535048-227535070 AAAAAGATAAAACACAAAGCAGG - Intronic
947205761 2:227659612-227659634 AAAATAATTAAGCACATAACAGG - Intergenic
947691235 2:232138171-232138193 AAAATTAAAAAATACCTATAAGG - Intronic
948115424 2:235491849-235491871 AAACTTATAAAACTCGTATAGGG + Intergenic
948189967 2:236050865-236050887 GAAATTATAAAACATTTATCAGG - Intronic
948396945 2:237651692-237651714 AAAATTTTAAATTACATATGTGG - Intronic
949076118 2:242059068-242059090 AAAATTTTAAAAGACAATTCTGG - Intergenic
1168864602 20:1074704-1074726 AAAATTAAAAAAAAAAAATCAGG + Intergenic
1169415181 20:5409869-5409891 GATATTGTAAAACACATATTTGG - Intergenic
1169513115 20:6286426-6286448 AAAATTTTAAATTACATATGTGG - Intergenic
1169528882 20:6462235-6462257 AATAATATAAAGAACATATCTGG + Intergenic
1169633252 20:7657552-7657574 AAAATAATAAAACATTAATCAGG + Intergenic
1169717536 20:8637300-8637322 AAAATTATAATATAGTTATCAGG - Intronic
1169915865 20:10682572-10682594 AAAATTATTAAAAAACTATCTGG - Intergenic
1170147835 20:13196759-13196781 AAAATTTTAAAATACATACATGG + Intergenic
1171217088 20:23360325-23360347 AAAATCATAAAACACGATTCTGG + Intergenic
1172869607 20:38127823-38127845 AAAATTCTAAATTACATATGTGG + Exonic
1173027426 20:39321294-39321316 AAAAATATTAAACAAAGATCAGG + Intergenic
1173066332 20:39716208-39716230 AAAAATACAAAAAACTTATCTGG + Intergenic
1173156676 20:40618991-40619013 AAAATTTTAAATTACATATGTGG + Intergenic
1173359423 20:42327901-42327923 AATATTTTAAAAATCATATCAGG + Intronic
1173386026 20:42588698-42588720 AAAATTTTAAATTACATATATGG + Intronic
1173544903 20:43888619-43888641 AAAATTATAAAAGAGAAAGCAGG - Intergenic
1173638398 20:44581339-44581361 AGAATTAAAAAACACATGTAAGG - Intronic
1173900650 20:46586145-46586167 AAAAATTTAAAATACATATGTGG + Intronic
1174007832 20:47424679-47424701 AAAATTATAAAACATAATTTTGG - Intergenic
1174026678 20:47582512-47582534 AAAATTAAAAAACAAAAGTCAGG - Intronic
1174751931 20:53119750-53119772 AAAATGTTAAATCACATATGGGG + Intronic
1174929943 20:54802475-54802497 AAAATAATAGAAGACATATGAGG + Intergenic
1176691056 21:9909754-9909776 AAATTTATAAAATACATTTATGG + Intergenic
1176785495 21:13251717-13251739 AAAATTATAAAACTCTTAGAAGG + Intergenic
1176806776 21:13491626-13491648 AAAAAAATATAACACATATTTGG + Intergenic
1176881299 21:14197679-14197701 AAAATTGGAAAACATATTTCAGG + Intronic
1177003906 21:15647134-15647156 AAAAATATAAATCACAAATGGGG + Intergenic
1177037751 21:16065280-16065302 AAAATTATAGAAAACAAATAGGG - Intergenic
1177060147 21:16362533-16362555 AAAATTATAAAATTCTTATCTGG + Intergenic
1177264723 21:18767381-18767403 AAAAATATAAAACAGACATCAGG - Intergenic
1177585198 21:23083778-23083800 AATATTATAAAATATAAATCAGG - Intergenic
1177588238 21:23127143-23127165 AAAATTAATATACACAAATCAGG - Intergenic
1177606386 21:23383903-23383925 AAAATTACACAACACATTTATGG + Intergenic
1177902312 21:26932391-26932413 AAACTTAAAAATCACATATGTGG + Intronic
1177920594 21:27147689-27147711 AAAATTTTAAATTACATATGTGG - Intergenic
1177927220 21:27233450-27233472 AAAATAATATAACACATTTTGGG - Intergenic
1177983537 21:27945424-27945446 AAAATTATAAAACTCTTAGAAGG + Intergenic
1178033640 21:28556307-28556329 AAAGTTGGAAAACACATTTCAGG + Intergenic
1178086430 21:29116549-29116571 AAAATTATTAAAAATATCTCAGG + Intronic
1178319393 21:31593764-31593786 AAAATTTTAAATTACATATATGG + Intergenic
1178856124 21:36251806-36251828 AAAATTAGAAAACAGAAGTCAGG - Intronic
1179415817 21:41197885-41197907 AAATTTATAAAACACACAAGAGG - Intronic
1180202524 21:46233551-46233573 AATATTATCAAATATATATCTGG - Intergenic
1180313302 22:11255366-11255388 AAATTTATAAAAAACGTAGCTGG + Intergenic
1180944869 22:19687237-19687259 AATATTTTAAAGCACATAACAGG + Intergenic
1181840619 22:25656475-25656497 AAAATTAAAAAAAAAGTATCTGG - Intronic
1182652666 22:31864848-31864870 AAAAATACAAAAAAAATATCTGG - Intronic
1182730047 22:32481198-32481220 TAAATTAAAATCCACATATCTGG - Intronic
1182862068 22:33568808-33568830 ATAGGTACAAAACACATATCTGG + Intronic
1183152722 22:36050681-36050703 AAACCTATAAATCAAATATCTGG + Intergenic
1183571299 22:38655677-38655699 AAAATTCCAAATCACATATGTGG + Intronic
1183637270 22:39071914-39071936 AAAAATATAAAAAAATTATCCGG + Intronic
1183991648 22:41601011-41601033 AAAATTATAAAATAGAAATCTGG + Exonic
1184613686 22:45623038-45623060 AAAATTTTAAAAAAAATAGCTGG - Intergenic
1184986334 22:48138260-48138282 ATATTGATAAAACACATATGAGG + Intergenic
949151884 3:779088-779110 AAAATTATAAAACAAATGCCAGG + Intergenic
949241773 3:1881246-1881268 AAAAGTATAAAAGATATACCTGG + Intergenic
949363874 3:3259883-3259905 AAGAGTACAAAACTCATATCTGG + Intergenic
949500038 3:4671056-4671078 AAACTCCTAAAACACACATCTGG - Intronic
950645799 3:14375897-14375919 AGATTTAAAAAACACATATTTGG + Intergenic
951142077 3:19174328-19174350 AAATTTTTAAAACACAAATATGG + Intronic
951178469 3:19630194-19630216 AAAATTTAAAATCACATATGTGG - Intergenic
951193710 3:19801012-19801034 AAAATTATACAAAATATCTCTGG + Intergenic
952131814 3:30372724-30372746 CAAATTATAGAACTGATATCTGG - Intergenic
952271573 3:31837888-31837910 AAAATGGAAATACACATATCAGG + Intronic
952361901 3:32638781-32638803 ATATTTATAAGACACTTATCTGG - Intergenic
952414305 3:33076445-33076467 AACATTTGAAAACACATATCTGG - Intronic
952680882 3:36090257-36090279 TAAAATATAAAACACATTTATGG - Intergenic
952761921 3:36922612-36922634 AAAAATACAAAAAACATAGCTGG + Intronic
952935109 3:38391340-38391362 GAAATTATAATACAAAAATCTGG - Intronic
953286809 3:41618182-41618204 AAAGTTAAAAAACATATTTCAGG + Intronic
953946724 3:47155198-47155220 AAATGTATAAATTACATATCAGG + Intronic
954480437 3:50795310-50795332 AAACTTGAAAAACATATATCAGG - Intronic
955011574 3:55021427-55021449 AGAAAGATAAAACACATCTCTGG - Intronic
955099177 3:55830781-55830803 AAAATTATAAAAAACTAACCAGG + Intronic
955274150 3:57531600-57531622 AAAAATACAAAAAAAATATCTGG + Intronic
955311834 3:57895780-57895802 AAAAATTTAAAAAAGATATCTGG + Intronic
955597000 3:60601756-60601778 AATATTATAAAACACTTATGAGG - Intronic
956978127 3:74605946-74605968 AAAAAGATAAAACACACATCAGG - Intergenic
957206784 3:77208940-77208962 AAAAATATATGAAACATATCAGG - Intronic
957277318 3:78107538-78107560 AAAATTCTAAAAAACATACGAGG + Intergenic
957321849 3:78641520-78641542 CAAATTATAACACAGATATCTGG + Intronic
957524986 3:81368621-81368643 AAAATTGCAAATTACATATCTGG + Intergenic
957746967 3:84357586-84357608 AAAATGAAAAAACAATTATCAGG + Intergenic
957853430 3:85841905-85841927 AATATTATTAAAAACATTTCAGG + Intronic
958261683 3:91388806-91388828 AAATAAATAAAACACATATTTGG + Intergenic
958417874 3:93897345-93897367 CAAATTATTGAACACATATGAGG + Intronic
959117419 3:102194748-102194770 CAAATTAAAAATCACATGTCTGG + Intronic
959287749 3:104438762-104438784 AAACTTTTAAAACTCATTTCCGG - Intergenic
959392221 3:105790443-105790465 AAAATTATAATCAACATATATGG + Intronic
959408121 3:105986733-105986755 AAAACTATAAAACAAAGACCGGG + Intergenic
959929005 3:111958407-111958429 AAAAGTATATACCACATATTGGG + Intronic
960080856 3:113538641-113538663 AAAATTTTCAAACACACATGTGG + Intronic
960251164 3:115455413-115455435 ATGTTCATAAAACACATATCTGG - Intergenic
960314214 3:116156420-116156442 AAATTAACAAAACACATATTTGG + Intronic
960594608 3:119396884-119396906 TCAATTAAAATACACATATCTGG - Intronic
960671393 3:120158126-120158148 AAAATAACAAAACACCTTTCTGG - Intergenic
960984518 3:123266234-123266256 AAAACAATAAAACAAAGATCTGG - Intronic
961049702 3:123735982-123736004 AGTATTTTAAAACAAATATCAGG + Intronic
961078986 3:124008661-124008683 ACATTTGTAATACACATATCTGG - Intergenic
961230796 3:125306414-125306436 AAAATTATTATACCAATATCAGG + Intronic
961239233 3:125395915-125395937 AAAATTTAAAAACTCATTTCTGG + Intergenic
961304488 3:125947817-125947839 ACATTTGTAATACACATATCTGG + Intergenic
961766357 3:129214280-129214302 AAAATTAAAAAAAAAATAGCTGG - Intergenic
962115071 3:132496836-132496858 AAAGATATAAAACAAATATTTGG - Intronic
962497864 3:135961055-135961077 AAAATTAAAAAACCAATAGCTGG - Intergenic
962724200 3:138205936-138205958 AAAATTTTAAATCACGTATGTGG - Intronic
963077809 3:141364057-141364079 AATATTGTAAAATATATATCTGG + Intronic
963178205 3:142323900-142323922 ATAATTATAACACACATTTATGG + Intronic
963516282 3:146313053-146313075 AAAAAAAAAAAACAGATATCAGG - Intergenic
963610914 3:147467101-147467123 AAAATTATAAGAGAAACATCTGG - Intronic
963719654 3:148847096-148847118 AAAATTACAAAACACATTAAGGG + Intronic
963898542 3:150711637-150711659 AAAATTAAAAAACAATTAGCTGG + Intergenic
964048648 3:152363315-152363337 AACATTTTAAAACAAAGATCAGG - Intronic
964333426 3:155628857-155628879 AAAGTTTTAAAACATATATATGG + Intronic
964585789 3:158299629-158299651 AAAAGTATAAAAGACACCTCAGG - Intronic
965086554 3:164106722-164106744 AAAATTAAAATACATATATTTGG + Intergenic
965178582 3:165368696-165368718 AAAAGTATAAATTACATATGTGG - Intergenic
965894350 3:173556164-173556186 AAAATAAGAAAACACAGATTAGG - Intronic
966030326 3:175338493-175338515 GAAATTATTAAACATTTATCAGG + Intronic
966227603 3:177614907-177614929 AAAATAATTAAACAAATTTCTGG + Intergenic
966413196 3:179664251-179664273 AAAAATACAAAAAAAATATCCGG - Intronic
966705006 3:182903709-182903731 AAAATTGTGATACACATATTTGG - Intronic
966848878 3:184152084-184152106 ACGATTATAAAACACACATGAGG + Intronic
967175427 3:186859244-186859266 AAAATTATAAATTACACATAAGG - Intergenic
967238105 3:187407932-187407954 TACATTATAAGACAAATATCTGG + Intergenic
967308187 3:188079715-188079737 ATATTTGCAAAACACATATCTGG + Intergenic
967383392 3:188885265-188885287 AAATGCATAAAACACTTATCAGG - Exonic
967480609 3:189969023-189969045 AAAATTTTAAAACAGAAAACTGG + Intronic
967520903 3:190431946-190431968 AAACTGATATAACACATATTTGG - Intronic
967607426 3:191464342-191464364 CAAATTATAAATCAAAAATCAGG - Intergenic
968841762 4:3012216-3012238 AAAATGATTAAATACATATTGGG + Intronic
968841902 4:3013401-3013423 AAAAGTAAAATACACATATGGGG + Intronic
969545205 4:7821709-7821731 AAAATTACTACACACATATCTGG - Intronic
969923336 4:10561056-10561078 AAAATTAAAAAAAAAATAGCTGG - Intronic
969966968 4:11006723-11006745 AAAATTTTAAATCTCATATATGG - Intergenic
970068942 4:12132978-12133000 AAAATTATATAACACATTTCTGG + Intergenic
970748058 4:19323541-19323563 ACAAGTGTAAAACACACATCAGG + Intergenic
971483437 4:27134842-27134864 AAAAATACAAAAAAAATATCTGG + Intergenic
971529546 4:27668780-27668802 ATAATTATAAAAGATATATGTGG + Intergenic
971558060 4:28038643-28038665 ATAGTTATAAAACACATACCTGG + Intergenic
971601116 4:28593446-28593468 AAAAATACAAAAAACATAGCTGG - Intergenic
971706759 4:30054495-30054517 AAAATTACAAAAGACATGTTGGG + Intergenic
971822596 4:31577758-31577780 AAACTAATAAAATACATATTTGG - Intergenic
971891795 4:32533567-32533589 AAAACTATAAAACACTGATGAGG + Intergenic
972074205 4:35063905-35063927 AAAATTATAAAACTGACATTTGG + Intergenic
972210061 4:36825523-36825545 AAATTTAAAAAACACATGTAGGG + Intergenic
972434501 4:39019496-39019518 AATAATATAAAACAAATATGTGG - Intronic
972503143 4:39696679-39696701 AAAAATATAAAAAAAATAGCTGG - Intergenic
972536398 4:40003327-40003349 AAAATTACAAAAAAATTATCTGG + Intergenic
973270463 4:48257261-48257283 AAAATTTTAAATTACATATGTGG + Intronic
973567928 4:52207123-52207145 AAAATAATAAAAGCCATATATGG - Intergenic
973666368 4:53163569-53163591 AAAAATATAAAACAATTAGCTGG + Intronic
973690219 4:53420268-53420290 AAAATTAAAAAAAAAATAGCTGG + Intronic
973819996 4:54654690-54654712 AAAATTATAAAAAACAAAAAAGG - Intergenic
973831374 4:54763420-54763442 AAAAGTTTAGAAAACATATCTGG - Intergenic
973906833 4:55540507-55540529 AAAATTAAAAAGCACACATGGGG - Intronic
974086373 4:57265156-57265178 AAAATAATAAAACATACATCAGG - Intergenic
974161287 4:58143594-58143616 AAAAACATAAAACTCAGATCAGG - Intergenic
974217964 4:58924805-58924827 AAAATAAAAAAACAAATATTTGG - Intergenic
974569160 4:63622399-63622421 AAAACTAAAAAGAACATATCTGG - Intergenic
974803571 4:66851241-66851263 GAAATTTTAAAACACAGATTTGG - Intergenic
974890627 4:67878068-67878090 AAAATTGTTAAAGACATAGCAGG - Intronic
975056411 4:69937162-69937184 AAAATTATTAAACCAATATGAGG + Intronic
975131236 4:70834922-70834944 AAGATTAAAAAATACCTATCGGG - Intronic
975713370 4:77182243-77182265 AAAATTAGAAAACAAATAGCCGG - Intronic
975860754 4:78674118-78674140 AAACTCATAAATCACATATGTGG - Intergenic
976183265 4:82419570-82419592 TAAACTATAAAACTCCTATCAGG - Intergenic
976319777 4:83700380-83700402 AAAAATACAAAATAAATATCTGG - Intergenic
976488662 4:85640887-85640909 AAAATTATAAAACAATTTTTTGG + Intronic
976747548 4:88419025-88419047 TCATTTATAAATCACATATCTGG - Intronic
976873496 4:89825217-89825239 AAAATTATAAAATTAATATATGG + Intronic
976895284 4:90102307-90102329 AAAATTATGAAAACCATATTTGG + Intergenic
976982236 4:91245291-91245313 AAGATTATAAAACACAAAGCAGG + Intronic
977242781 4:94593267-94593289 AAGATTATAAAATTCATCTCTGG + Intronic
977414506 4:96715035-96715057 AAAATAATAGAAAACATTTCTGG + Intergenic
977475556 4:97503486-97503508 AAAAATACTAAACACATATAAGG - Intronic
978025366 4:103867190-103867212 AAAATTATAAAAGACAAAGAAGG - Intergenic
978041038 4:104062345-104062367 AAAAATATAATACACATTTTGGG - Intergenic
978042826 4:104091377-104091399 AAAATAAGAAAACCCAAATCAGG + Intergenic
978372903 4:108047049-108047071 AAAATTATGAAATACAGCTCAGG + Intergenic
978728551 4:111998858-111998880 AAAATCAAAAAACAGATATGAGG + Intergenic
978751804 4:112258025-112258047 AAAACTAAAAAACATATAACAGG - Intronic
978973909 4:114845168-114845190 AAAAATATAAAACAAATAGGCGG + Intronic
980017519 4:127669215-127669237 AAAATGCTAAAACAAGTATCTGG + Intronic
980109780 4:128623995-128624017 GAAACTATAAAACACATGTGGGG + Intergenic
980222354 4:129935611-129935633 AAAATTAAAAAAAAATTATCTGG - Intergenic
980363632 4:131769932-131769954 AAATTTATAAAATACATTTATGG + Intergenic
980721582 4:136703787-136703809 AAAATTATAAACAACCTATGTGG + Intergenic
980823492 4:138045816-138045838 AAAATTTTAAAACATAAGTCTGG + Intergenic
980951932 4:139388657-139388679 AAAATTATAAGAAACCTATAAGG + Exonic
981131726 4:141164362-141164384 CAAATTAGAAAACACTCATCAGG + Intronic
981242622 4:142495798-142495820 AAAATCAGAGAACACATAGCTGG - Intronic
981374981 4:144004604-144004626 AAAAAAAAAAAACACTTATCTGG + Intronic
981576634 4:146212814-146212836 AAAATTTTAAATTACATATGTGG + Intergenic
981775729 4:148365148-148365170 AAAAATATGAGACACATATCTGG + Intronic
981885581 4:149668703-149668725 AAAATTAAATAACAAATATTAGG + Intergenic
981947071 4:150360107-150360129 AAAATTTTAAATTGCATATCTGG - Intronic
982009591 4:151093743-151093765 AAAAATACAAAAAACTTATCTGG + Intergenic
982243097 4:153320379-153320401 AAAATTTAAAAATACATATGTGG + Intronic
982353031 4:154437004-154437026 AAAATTTTAAATCATGTATCTGG + Intronic
982372781 4:154652474-154652496 GAAATTAAAATACATATATCTGG + Intronic
982571277 4:157053097-157053119 AAAATTAGAAAACACATGACAGG + Intergenic
982752128 4:159175060-159175082 AACATTATAAGACACATGTATGG - Intronic
982999145 4:162389621-162389643 AAAATTAAAAAACAGAGATCAGG + Intergenic
983420823 4:167514095-167514117 AAATTTATAAAATCCATATAGGG - Intergenic
983518442 4:168680499-168680521 AAAAAAAAAAAACACTTATCTGG + Intronic
983600946 4:169526747-169526769 AATATCAGAAAACACATATTGGG + Intronic
983748564 4:171233181-171233203 AAAATAACTAAACACATATGAGG - Intergenic
983765169 4:171471303-171471325 AAGAAAATAAAACACATCTCAGG + Intergenic
984040263 4:174724510-174724532 AAAATTATAAGACAGATGTAAGG - Intronic
984231000 4:177098741-177098763 AAAATATTAAAAAACAAATCAGG - Intergenic
984423279 4:179552291-179552313 AAAATTATAAGCCAGATGTCTGG + Intergenic
984840518 4:184063294-184063316 ATAATAATAAAGCACATACCAGG - Intergenic
985256074 4:188071129-188071151 AAAATTATAAACAACATAACTGG + Intergenic
985425977 4:189830509-189830531 CAAATTATACAACACATGTAAGG - Intergenic
986834885 5:11625501-11625523 AAAATTATAAAACCTCTATAAGG + Intronic
987480744 5:18454332-18454354 AAAATAATAAAACAAAAATTGGG - Intergenic
987683842 5:21171444-21171466 AAAATTATGAAAGACAGATAAGG - Intergenic
988002753 5:25369681-25369703 AAAATTACTAAAGAAATATCAGG + Intergenic
988049238 5:26003099-26003121 AAAATTATAAAACTTTTATTTGG - Intergenic
988234167 5:28519068-28519090 AAAATTTAAAAACAAATATTAGG + Intergenic
988301914 5:29440095-29440117 AAAATAATGAGACAAATATCAGG - Intergenic
988344375 5:30018934-30018956 ACATTTATAAACCATATATCTGG + Intergenic
988345445 5:30031721-30031743 AAAAATATAAATTACATACCTGG - Intergenic
988387439 5:30583489-30583511 TAAAGGGTAAAACACATATCAGG - Intergenic
988568403 5:32340233-32340255 AAAAATACAAAACATTTATCTGG - Intergenic
988660089 5:33256909-33256931 TGAATTATAAAACTCATATTAGG - Intergenic
988816792 5:34842097-34842119 AAAATTTTAAATTACATATGTGG - Intronic
988938615 5:36117583-36117605 AAAATAATGAAGCACATTTCTGG + Intronic
989018243 5:36967013-36967035 ATAAATATAAAACAAATATGGGG + Intronic
989299164 5:39868519-39868541 AAAAGTATAAACCTCATAGCAGG - Intergenic
989535448 5:42558463-42558485 AAAATTTTAAATTACATATGTGG - Intronic
989542926 5:42638714-42638736 AAAATTTTAAATTACATATGTGG + Intronic
989782102 5:45279850-45279872 AAAATTATCAAATACTTAGCTGG + Intronic
989813610 5:45708637-45708659 AAATTTATTAAACATATATTGGG - Intergenic
990363298 5:55043410-55043432 AAAATTCTTAAACCAATATCTGG - Intergenic
990391043 5:55321265-55321287 AGAATTGTAAATCAGATATCAGG - Intronic
990489451 5:56289957-56289979 AAAATTAAAAAAAAAATGTCAGG + Intergenic
990618697 5:57536449-57536471 AAAATTCTAAAACAAATCTATGG - Intergenic
991234695 5:64379988-64380010 AAAATATTAAACCAAATATCTGG + Intergenic
991851067 5:70923199-70923221 AAAATTTTAAATCTCATGTCAGG - Intergenic
991939504 5:71837100-71837122 GAAATTACAAAACACAGATAAGG - Intergenic
992011171 5:72529246-72529268 ATAATTAAAAATCACATATGTGG - Intergenic
992050872 5:72939544-72939566 AAAAATATAAAAAAATTATCTGG + Intergenic
992150725 5:73899861-73899883 AGAAGAATAAAACACAGATCAGG - Intronic
992454507 5:76904160-76904182 ATATTTGTAAAACACATATTTGG - Intronic
993001185 5:82382330-82382352 AAAATTTTAAAAAACTTAGCTGG + Intronic
993104868 5:83588710-83588732 AAAAATTTAAAAATCATATCAGG - Intergenic
993251825 5:85536331-85536353 AACATTATAATACACAAATTGGG + Intergenic
993287509 5:86017854-86017876 AACAATATATAATACATATCTGG + Intergenic
993363464 5:87006132-87006154 AAAATTGGAAAACACAGATATGG - Intergenic
993615075 5:90101279-90101301 CAAATTATAAAGCATATATAGGG - Intergenic
994005273 5:94829424-94829446 AAAAATTTAAAACGGATATCTGG - Intronic
994213891 5:97115667-97115689 AAATGTATAAAACACATTTTAGG + Intronic
994452384 5:99958798-99958820 GAAAATACAAAACACAGATCAGG - Intergenic
994474869 5:100254101-100254123 AATATTTTAAAACAAATTTCTGG - Intergenic
994590435 5:101765099-101765121 AAATTGATAAAACTCATATTTGG + Intergenic
994644736 5:102454047-102454069 AAAAATGTAAAAGATATATCTGG - Intronic
994800944 5:104374435-104374457 CAAATCCTAAAACACATATTAGG - Intergenic
994837732 5:104877332-104877354 AAAAATTTAAAATAAATATCTGG + Intergenic
994977146 5:106823436-106823458 AAAATTTTAAAACATTTATCAGG - Intergenic
995156905 5:108925756-108925778 AATAATATAAGACACATATTTGG - Intronic
995333529 5:110973154-110973176 GAAATTATTAGACAGATATCTGG - Intergenic
995442992 5:112212452-112212474 AAAATTATAAAAAAATTAGCTGG - Intronic
995509610 5:112895075-112895097 AAAATTAGAAAAAAAATAGCCGG + Intronic
995738737 5:115332282-115332304 AAAATTATTGTACAGATATCTGG + Intergenic
996205780 5:120733466-120733488 AATATTATAAAATATATATTTGG + Intergenic
996240611 5:121196213-121196235 GAAATTATAAAATACTTAACTGG - Intergenic
996244430 5:121243658-121243680 AAAATCATAAAACTCCTATAAGG + Intergenic
996247807 5:121286416-121286438 AAAATTATAGAAAACCTCTCAGG - Intergenic
996882348 5:128313863-128313885 AAAAAAAAAAAAAACATATCTGG + Intronic
996939957 5:128992577-128992599 AAAAATGTAAAACATTTATCTGG - Intronic
996982456 5:129515468-129515490 AAAACTATAAAACACTGATGAGG - Intronic
997012779 5:129898472-129898494 AAAATTTTAAATTACATATGTGG + Intergenic
997193501 5:131962015-131962037 AAAATTAAAAAAAAAATAGCTGG + Intronic
997830260 5:137143642-137143664 AAACTTAATAAACACATATGAGG - Intronic
997842546 5:137255556-137255578 AAAACAAAAAAAGACATATCGGG + Intronic
998486704 5:142509296-142509318 AAAATTGAAAAGCACATTTCCGG + Intergenic
998657614 5:144199612-144199634 ACAGTTTTAAAACACATATGTGG + Intronic
998740028 5:145190049-145190071 TAAACTCTAATACACATATCAGG - Intergenic
998850767 5:146348624-146348646 AAAATTACAAAAAACTTAGCTGG + Intergenic
999059742 5:148620694-148620716 AAAATTTAAAATCACATATGTGG + Intronic
1000022709 5:157332570-157332592 AAAATTACAAAGGACATAACTGG - Intronic
1000330989 5:160205067-160205089 AGAATTATAAAAAATATATGTGG + Intronic
1000583530 5:163064882-163064904 AAAATTATAGGAAACATATATGG + Intergenic
1000642924 5:163725534-163725556 AATATTGTTAACCACATATCTGG - Intergenic
1000723288 5:164735268-164735290 ACAAGTAGAAAACACAAATCTGG + Intergenic
1000781797 5:165491548-165491570 AAAAATAAAAAACAAATACCTGG + Intergenic
1000839353 5:166197318-166197340 ATAATGATAAAACACTTATTAGG - Intergenic
1001393053 5:171395915-171395937 AAAATTAAAAAAGACATTTAAGG - Intronic
1001750328 5:174125095-174125117 AAAATAATAAAAGCCATATGTGG - Intronic
1001846675 5:174928200-174928222 AAAAATATAAAAAAAATAGCCGG + Intergenic
1002077422 5:176717177-176717199 AAAAAAATAAAACAAGTATCAGG + Intergenic
1002594839 5:180315337-180315359 AAAAATATAAAACAATTAGCCGG - Intronic
1002681687 5:180970026-180970048 AAAATTAAAAAAAAAAAATCAGG + Intergenic
1002976020 6:2077420-2077442 AAAATCATAAAGGACATATATGG - Intronic
1002980810 6:2135716-2135738 AAAATTAAAAATTACATATGTGG - Intronic
1003777509 6:9385277-9385299 AAAATTATAAAACTTACATCGGG - Intergenic
1003803440 6:9698213-9698235 AAACTTATAAAAAAGTTATCAGG + Intronic
1003857268 6:10289351-10289373 AAGATCATAAAACATAAATCTGG + Intergenic
1004050270 6:12070953-12070975 AACATGATAAAACACAAACCAGG + Intronic
1004075030 6:12337282-12337304 AAAATTATAAAATACAAGCCAGG - Intergenic
1004227698 6:13801876-13801898 AAAAACAAAAACCACATATCTGG + Intronic
1004348886 6:14873795-14873817 AAAAATAAAAAACACCTATCAGG - Intergenic
1004379177 6:15117475-15117497 AAATTTAGAAAACACAGATGGGG + Intergenic
1004679696 6:17881162-17881184 CAACTTATAAAACTCATACCAGG + Intronic
1004958239 6:20754702-20754724 ACTTTTATAAATCACATATCTGG - Intronic
1005108341 6:22250223-22250245 GAAATTTTTAAACACATAGCAGG + Intergenic
1005125721 6:22444100-22444122 AAAATTGTAAAACAGATGTTTGG + Intergenic
1005289929 6:24369878-24369900 AAAATTACAAAAAAAATAGCCGG + Intergenic
1005333231 6:24768881-24768903 AAAATCAAAAAACACATGGCCGG - Intergenic
1005573484 6:27170179-27170201 ATATTTATAAATCATATATCTGG - Intergenic
1005629717 6:27696081-27696103 AAAAGTAAAAAACACATGGCTGG - Intergenic
1005795340 6:29354855-29354877 AAAAATATGACACACATATGAGG + Intergenic
1006080348 6:31561702-31561724 AAAATTATTAAGCACCTATTAGG + Intergenic
1006201171 6:32292774-32292796 TAACTTATAAAACAAATATTTGG + Exonic
1006819253 6:36878225-36878247 AAAACCAGAAAACACATATATGG - Intronic
1006958312 6:37898622-37898644 AAAATTATAAAACACTTCTGAGG - Intronic
1007435519 6:41807740-41807762 TAAATTAAAAAACACATATACGG - Intronic
1007540770 6:42641689-42641711 AGAATTAGAAAACACTTACCTGG - Exonic
1007801344 6:44396513-44396535 AAAAAAAAAAACCACATATCTGG - Intronic
1007884929 6:45216789-45216811 ATAATTTTAAAATATATATCAGG - Intronic
1008064363 6:47031708-47031730 ATAATTATAATATACATAGCTGG - Intronic
1008115671 6:47546587-47546609 AAAAGTTTAAAAAACATATTTGG + Intronic
1008119519 6:47596106-47596128 AAAATAAGAAAAAACATACCTGG - Intronic
1008438900 6:51509856-51509878 TAAATTATGTAACACATGTCTGG + Intergenic
1008473030 6:51905358-51905380 AAAATTATATACCACATTTCTGG - Intronic
1008981825 6:57492248-57492270 AAAATTTTAAATTACATATGTGG - Intronic
1009169899 6:60385071-60385093 AAAATTTTAAATTACATATGTGG - Intergenic
1009182082 6:60530426-60530448 AAATAAATAAAACACATATTTGG - Intergenic
1009476575 6:64099021-64099043 AAAATTAGAGAACACTTATAAGG + Intronic
1009488340 6:64254209-64254231 AAAATTTTAAAACATTTCTCAGG + Intronic
1009522454 6:64700235-64700257 AAAATAATAAAAGCCATATAAGG + Intronic
1009927331 6:70135533-70135555 AATATTGTAAAATACATATTTGG - Intronic
1010073856 6:71777422-71777444 AAAAGTAGAAAACAAATAGCAGG - Intergenic
1010094501 6:72025233-72025255 AAAAGTCTAAAACAAATATAAGG - Intronic
1010391226 6:75340188-75340210 AAAACTATGAAATACATAGCTGG - Intronic
1010935001 6:81850390-81850412 AGAATTATAACACACATATAGGG - Intergenic
1011397759 6:86928008-86928030 AAATTTATAAAACAGAAAACAGG + Intergenic
1011441029 6:87387646-87387668 AAAAATATGACATACATATCTGG + Intronic
1011592170 6:88980805-88980827 AAAAATATAAAAGCCATATGTGG - Intergenic
1011850836 6:91626825-91626847 AAAATAGTGAAAAACATATCAGG - Intergenic
1011933922 6:92751265-92751287 AAACTTAAAAAAATCATATCAGG - Intergenic
1012027233 6:94011365-94011387 AGAAGAATAAAACACATTTCAGG - Intergenic
1012305228 6:97647575-97647597 AGAATTTTAAATTACATATCTGG + Intergenic
1012478782 6:99644668-99644690 GAAATTATAAATTACATATTTGG - Intergenic
1012822259 6:104100722-104100744 ATATTTATAAAAGACACATCAGG + Intergenic
1012838539 6:104300032-104300054 AAAATTATAAAAAAATTAGCAGG - Intergenic
1013285576 6:108678688-108678710 AAAATTACATAACACATATATGG - Intronic
1013502224 6:110764043-110764065 AAAAGTATAAAATATATATAAGG + Intronic
1014214006 6:118735721-118735743 AAAATTGTAAAGCACATGTGTGG - Intergenic
1014286123 6:119500873-119500895 AAAATTAAAATACACATTTTTGG + Intergenic
1014392963 6:120886948-120886970 AAATTTATAAAACATTTATAAGG + Intergenic
1015134326 6:129850621-129850643 AAAATTTTAAATTACATATGTGG - Intronic
1015720881 6:136240633-136240655 AAATTTATAAAACAATCATCTGG + Intronic
1016376961 6:143430873-143430895 AAAATTTTAAAAAACAGAGCAGG + Intronic
1016377775 6:143441259-143441281 AAACTTACAAACCACATCTCTGG + Intronic
1016472660 6:144390804-144390826 AAAATTATAACTAATATATCAGG - Intronic
1016710163 6:147161905-147161927 GAAATTATATAACACATAGTGGG + Intergenic
1017051812 6:150400352-150400374 AAAATTATAATGCAAACATCTGG + Exonic
1017579756 6:155850688-155850710 AACATAATAAATCACATAACTGG + Intergenic
1018623946 6:165759250-165759272 AAACTTATAAAACCCATCTGAGG - Intronic
1019025763 6:168961728-168961750 AAAAATATAAGCCACAGATCTGG - Intergenic
1019056763 6:169229340-169229362 AAAATTATTCAAAACATTTCCGG + Intronic
1019096209 6:169581966-169581988 AAAAATAAAAAATAAATATCAGG - Intronic
1019885678 7:3902862-3902884 AAAATTGCAAACCATATATCTGG + Intronic
1020285269 7:6674375-6674397 AACATCAGAAAACACATATAGGG + Intergenic
1020489643 7:8764669-8764691 AAAATGATTAAACATATATATGG + Intergenic
1020496588 7:8860629-8860651 AGAATTATAAAATACATGTTAGG + Intergenic
1020984523 7:15116364-15116386 AAAATTATAAAACTCCTAGTAGG + Intergenic
1021324408 7:19247765-19247787 AAATTTATCAAATACATATATGG - Intergenic
1021440971 7:20675740-20675762 AAAATTGGAAACCATATATCTGG + Intronic
1021853557 7:24832043-24832065 AAAAATACAAAAGACATAGCTGG + Intronic
1022429558 7:30303119-30303141 AAAAATAGAAAACAATTATCCGG + Intronic
1022631515 7:32089813-32089835 AAACCTACAAATCACATATCTGG + Intronic
1022644876 7:32220654-32220676 AAAAATATAAAAAAAATAGCTGG + Intronic
1022779309 7:33562272-33562294 AAAGTGATAAAAAACATATATGG + Intronic
1023494522 7:40780279-40780301 AAAATTTAAAAACACAAGTCAGG - Intronic
1023572475 7:41586585-41586607 ATAATTATAAATAAAATATCTGG - Intergenic
1024158771 7:46652944-46652966 AAAAAAGTAAAAAACATATCTGG + Intergenic
1024180153 7:46884113-46884135 AACCTTAAAAAACACAAATCAGG - Intergenic
1024405516 7:48975120-48975142 AAAATTTTAAAACAAAGATTTGG + Intergenic
1024830006 7:53440275-53440297 ATATTTTCAAAACACATATCTGG - Intergenic
1025004082 7:55342080-55342102 AAAATTAAAAAAAACTTAGCGGG - Intergenic
1027142972 7:75672780-75672802 AAACTTATAAAACTCATAGAGGG - Intronic
1027787766 7:82601944-82601966 AAAATTATAAAACATATGAAAGG - Intergenic
1027830661 7:83173131-83173153 AAAATTTTAAAAAACATACTGGG - Intergenic
1028000033 7:85482845-85482867 AAAATTATAAAACCCATATTTGG - Intergenic
1028066351 7:86390064-86390086 CAAATTATAACAGTCATATCAGG - Intergenic
1028072361 7:86466736-86466758 ATAATTATAAAACAAATCTGTGG - Intergenic
1028085465 7:86631551-86631573 AAAATTCTACCACACATCTCTGG + Intergenic
1028247246 7:88495014-88495036 AAAATAATCTAACACATATGAGG - Intergenic
1028313547 7:89370289-89370311 AAAATTTCAATACCCATATCAGG + Intergenic
1028541293 7:91945204-91945226 AAAAGTATAAAAAACAAAACAGG + Intronic
1028644311 7:93077916-93077938 AATATTAGAAAACACACTTCAGG + Intergenic
1028732948 7:94173953-94173975 AAAATTAAAAATTACATATGTGG + Intergenic
1028788295 7:94822363-94822385 AAAAATATAAAATACTTATAAGG + Intergenic
1028885186 7:95924512-95924534 AAAATTTTAAATTACATATGTGG + Intronic
1029296026 7:99541238-99541260 AAAAATACAAAAAAAATATCCGG - Intergenic
1029336473 7:99904208-99904230 AAAATTCTAAGTAACATATCAGG + Intronic
1029560245 7:101298090-101298112 AAAATAAAAAAACACAGATCTGG + Intergenic
1029583184 7:101451864-101451886 AAAAATACAAAAAACATAGCTGG - Intronic
1030271160 7:107669732-107669754 AAAACTAGAAAATACATATAAGG + Intronic
1030273167 7:107691816-107691838 AAAATAATACAGCTCATATCCGG + Intronic
1030331837 7:108279335-108279357 ACAATTATGAAACACAAAACAGG - Intronic
1030405909 7:109113116-109113138 AAAATTATAAAAAAAATTTTAGG + Intergenic
1031763556 7:125744830-125744852 AAAATAATATAGAACATATCTGG + Intergenic
1031842869 7:126767518-126767540 AAAATTATAAATCACATTGTCGG + Intronic
1032342125 7:131083862-131083884 AAATGTATAAAACACATCTGAGG + Intergenic
1032388422 7:131540205-131540227 AAAATAATCAAAAACATAGCTGG - Intronic
1032866120 7:135925913-135925935 AAAATTAAAAAACAATTAGCTGG - Intergenic
1033070780 7:138199999-138200021 AAAATTAATATACAAATATCAGG + Intergenic
1033177174 7:139135445-139135467 AAAATTTTAGAACACATAATAGG - Intronic
1033226389 7:139566515-139566537 AAGATTAAAAATCACATCTCAGG + Exonic
1033721872 7:144068925-144068947 AAAATTATAAGACATATAGAAGG + Intergenic
1033785542 7:144726287-144726309 ATGATTAAAAATCACATATCAGG + Intronic
1033972582 7:147060559-147060581 AAAAGTACAAAAAAAATATCTGG + Intronic
1034394961 7:150815369-150815391 AAAATTACAAAAAAATTATCCGG + Intergenic
1034466170 7:151230702-151230724 AAAATTTTAAACAACATATATGG + Intergenic
1034596566 7:152200431-152200453 TAAATTATAAAATACAGGTCGGG + Intronic
1035143428 7:156787614-156787636 GAAATTATAAAAAATAAATCAGG - Intronic
1035250395 7:157593450-157593472 AAAATGAAAGAACACATATTTGG + Intronic
1036406327 8:8458581-8458603 AAAATTGTACAATACATTTCTGG + Intergenic
1036439625 8:8769300-8769322 ATATTTATAAATCATATATCTGG - Intergenic
1036450143 8:8858919-8858941 AGAAATATAAAACAGATATCTGG - Intronic
1036538910 8:9683842-9683864 AAAATTATAAAACATCAATAAGG + Intronic
1037031840 8:14117256-14117278 AAAATGTAAAAGCACATATCTGG - Intronic
1037106743 8:15118136-15118158 AGTTTTATAAATCACATATCAGG + Intronic
1037229323 8:16636204-16636226 ACAATTAAAATACACATACCTGG - Intergenic
1038587008 8:28798999-28799021 AAAAATATATAACACAGGTCAGG + Intronic
1038719987 8:30027188-30027210 AATATTTGCAAACACATATCTGG + Intergenic
1038915600 8:32018112-32018134 GATATTATAAAACATGTATCTGG - Intronic
1039044880 8:33440860-33440882 AAAAGTATATAACACAAAGCTGG + Intronic
1039159278 8:34598679-34598701 TAAAATATAAAACACACACCTGG + Intergenic
1039403114 8:37289463-37289485 AAAAACATAAAACGCATATTAGG - Intergenic
1039515761 8:38132145-38132167 AAAATTAAAACACACACATGTGG - Intronic
1040036240 8:42872881-42872903 TAAATTATAAAACCCTTATTGGG + Intronic
1040080573 8:43280706-43280728 AAACTTAGAAAACTCATCTCTGG - Intergenic
1040407254 8:47117768-47117790 AAAAGTATAAAAAAAATAGCCGG + Intergenic
1040627870 8:49172629-49172651 AAAATAATAGAACACATTCCTGG - Intergenic
1040719104 8:50295376-50295398 AAAATGATTAAAGACATATATGG - Intronic
1041103982 8:54424161-54424183 AATATTATAAATCAGAAATCTGG - Intergenic
1041131083 8:54701196-54701218 AAAATGATAAGATACATATTAGG + Intergenic
1041158795 8:55016160-55016182 AAAATTATAAAATCCATAAGAGG - Intergenic
1041535842 8:58924729-58924751 GAAAATATCAAACACCTATCGGG - Intronic
1041936973 8:63343681-63343703 ATATTTGCAAAACACATATCTGG - Intergenic
1042291503 8:67173385-67173407 AAAATTACACAACACACATTTGG - Intronic
1042382964 8:68139983-68140005 AAAACTTTAAACAACATATCAGG - Intronic
1042476293 8:69251990-69252012 AAAAATAAAAATCACATTTCTGG - Intergenic
1042594711 8:70434727-70434749 AAAATTTTAAAAAAATTATCTGG - Intergenic
1042623049 8:70727249-70727271 AACATTATAAAAAAGATATGGGG + Intronic
1043078589 8:75735332-75735354 AAAATTAAATAACATATATGGGG - Intergenic
1043093518 8:75934957-75934979 AAAATTTTAAAACTTACATCAGG - Intergenic
1043303560 8:78765413-78765435 ATATTTACAAAAGACATATCTGG + Intronic
1043320873 8:78984515-78984537 AAAATTTTAAACTACATATGTGG - Intergenic
1043583421 8:81739256-81739278 AAAATTAAAAAAAAAATAGCTGG - Intronic
1043605634 8:81995518-81995540 TAAATTATTTAACAAATATCTGG + Intergenic
1043662521 8:82762254-82762276 AAAAACATAAAAAATATATCAGG + Intergenic
1043802635 8:84629791-84629813 AAAATTAGAAAACACACAAAAGG - Intronic
1043842738 8:85127832-85127854 ACATTTATAAAACACAAATAAGG - Intronic
1044157763 8:88870846-88870868 AAAGTTACAAAAAACATATAGGG - Intergenic
1044180888 8:89192594-89192616 AAAAAAATAAAACTCATGTCTGG + Intergenic
1044316509 8:90755261-90755283 AAGATTATAAAACTAATAACAGG + Intronic
1044500987 8:92956617-92956639 AAAATCATTCAAGACATATCTGG - Intronic
1044660392 8:94589493-94589515 AAAATAAAAAAAGACATATTAGG + Intergenic
1044883852 8:96754114-96754136 AAAATTCTAAATAACAAATCTGG - Intronic
1046186062 8:110720936-110720958 AAATTTTTAAAATACATATTTGG - Intergenic
1046577883 8:116054367-116054389 AAAATTCCAAAACACACTTCAGG - Intergenic
1046918213 8:119699712-119699734 AAAATTAAAAAAAACTTTTCTGG - Intergenic
1047088757 8:121549829-121549851 TAAATTATAAAACATAAATTAGG - Intergenic
1047097557 8:121640762-121640784 AAAATTTTAAAACAATTATAAGG + Intronic
1047147868 8:122225669-122225691 AAAATTATTGAACAAATATGTGG + Intergenic
1047244445 8:123127430-123127452 AAAAATATAAAAAACTTAGCTGG - Intronic
1047546996 8:125827914-125827936 GAAAATATTAAACACCTATCAGG - Intergenic
1047745129 8:127839386-127839408 AAAATTATAAAAAAATTAGCCGG + Intergenic
1048023592 8:130563695-130563717 AAAATTGGAAAACAAATAACTGG + Intergenic
1048104238 8:131389969-131389991 AAAATTAAAAAACAGAGATACGG - Intergenic
1048322708 8:133412748-133412770 AATATCATATAACACATACCAGG - Intergenic
1048465054 8:134658713-134658735 AAAATAATAATACAAAGATCTGG - Intronic
1048702827 8:137113019-137113041 AAAACTATAAAACTCATAGAAGG - Intergenic
1049127760 8:140807806-140807828 AAAATTTTAAATCACCTATGAGG + Intronic
1050460805 9:5875853-5875875 TAAATTAAAAAACAGATCTCAGG + Intergenic
1050692033 9:8239042-8239064 AAACCTATAAAGCACATAGCAGG + Intergenic
1050839237 9:10125998-10126020 AAACCTATAAAACACATTTTGGG + Intronic
1050919013 9:11175520-11175542 AAAAATATAAAAAACATAATGGG + Intergenic
1051085843 9:13348183-13348205 AAAAATAAAAAACAATTATCTGG + Intergenic
1051279194 9:15424151-15424173 AAAATGAAAAAACACACAGCAGG - Intronic
1051515105 9:17921844-17921866 AAAATTAAAAAACAAAAATAGGG - Intergenic
1051588857 9:18755469-18755491 ATAACCATAAAAAACATATCAGG - Intronic
1051607707 9:18931917-18931939 AAATTTGTAAATCACATACCTGG - Intronic
1051688439 9:19683267-19683289 ACAATTATAAAACTGATAGCAGG + Intronic
1051811898 9:21058680-21058702 AAAAATATCAAACAGATTTCTGG + Intergenic
1051987098 9:23103426-23103448 AAAATAATGAACCACATTTCTGG + Intergenic
1052196440 9:25721407-25721429 AAAAATAAAAAATACATATTTGG - Intergenic
1052418055 9:28203038-28203060 AAAATTTTAAAACAAAAAGCAGG + Intronic
1052449183 9:28605299-28605321 GAAATTTTAAATCACATATGGGG + Intronic
1052474441 9:28940460-28940482 AAAGTTAAAAAAAACATATGGGG - Intergenic
1052707664 9:32012064-32012086 AAAATTATTTAAAATATATCAGG - Intergenic
1053492151 9:38516061-38516083 CAAATTATTTAACAAATATCAGG - Intergenic
1053627856 9:39894571-39894593 AAATTTATAAAATACATTTATGG + Intergenic
1054216032 9:62356131-62356153 AAATTTATAAAATACATTTATGG - Intergenic
1054671448 9:67799218-67799240 AAATTTATAAAATACATTTATGG + Intergenic
1054872799 9:70064430-70064452 AAAATTTTAATTCATATATCCGG - Intronic
1054995988 9:71389968-71389990 AAAATTAAAAAAAACTTATTTGG + Intronic
1056074659 9:83026174-83026196 AAAATTAAAAAATACACAGCAGG - Intronic
1056136518 9:83634519-83634541 AAAATTACAGAAAACATATTTGG - Intronic
1056207126 9:84330870-84330892 AAAGTTTTAAATTACATATCTGG + Intronic
1056495719 9:87153153-87153175 AAAAATATAAAACAATTAGCCGG - Intronic
1056743226 9:89277980-89278002 AAAATTAAGAAACAAATATTGGG - Intergenic
1057365672 9:94418381-94418403 AAAATTATAAAAAAGAAATGTGG - Intronic
1057657663 9:96969699-96969721 AAAATTATAAAAAAGAAATGTGG + Intronic
1057968096 9:99524283-99524305 ACACTTACAAAATACATATCTGG + Intergenic
1058154679 9:101502070-101502092 AAAAATACCAAACACATCTCAGG + Intronic
1058202369 9:102060129-102060151 ATAATTATAAAATTAATATCTGG - Intergenic
1058277772 9:103067092-103067114 AAAAATACAAAAAACATAGCCGG - Intergenic
1058476472 9:105339171-105339193 ATATTTATAAATCAGATATCTGG + Intronic
1058640700 9:107081277-107081299 AAAATTAGAGCACACATCTCAGG - Intergenic
1059100538 9:111467557-111467579 TAAATTTTAAAATACAAATCAGG + Intronic
1059142564 9:111867991-111868013 AAAATTATAAAATACATATTAGG - Intergenic
1059686871 9:116646226-116646248 AAAATTAAAAAACAGATAAGTGG - Intronic
1059826952 9:118041469-118041491 AAAATTCTAATATACATATTTGG - Intergenic
1060015339 9:120081695-120081717 AAAAATAAAAAAGAAATATCTGG + Intergenic
1060353705 9:122883682-122883704 TCATTTATAAAACACATAGCTGG + Intronic
1060371547 9:123078008-123078030 AAACTGATATAACACATCTCAGG + Intronic
1060651495 9:125331186-125331208 AAAATTATAAAACACATATCAGG - Intronic
1061049202 9:128184436-128184458 AAAATTTTAAATTACATATATGG + Intronic
1061172063 9:128964302-128964324 AAAGTTGTAAAACATCTATCTGG - Intronic
1061321571 9:129834110-129834132 CAAATTACAATACACACATCTGG + Intronic
1061596054 9:131629806-131629828 AAAAATATAAAACATAAATTTGG - Intronic
1061632351 9:131880826-131880848 AAATGTATAAAACACAGATTTGG - Intronic
1062588186 9:137260209-137260231 AAAAATACAAAAAACATAGCTGG - Intronic
1062620683 9:137420213-137420235 AAAATCATAAAAAGCATTTCAGG - Intronic
1062626217 9:137443263-137443285 AAAATTATGAAACAAAAAGCAGG - Intergenic
1203747365 Un_GL000218v1:48309-48331 AAAATAAAAAAACACAAAACTGG - Intergenic
1185973322 X:4688710-4688732 AAAATTACAAAACACTCAGCCGG - Intergenic
1186474212 X:9844651-9844673 AAAATTATAAAAAAATTAGCTGG + Intronic
1186692239 X:11990482-11990504 AAAATTAAAAAAGAAATCTCAGG + Intergenic
1186827717 X:13357885-13357907 ATAATTCTAAAACAGATATAGGG - Intergenic
1187072515 X:15902261-15902283 AAGATTATATTACACATATAAGG - Intergenic
1187082343 X:16004299-16004321 ATAATTGGCAAACACATATCAGG + Intergenic
1187115848 X:16349692-16349714 AAAATTAAAAAGCACTTATATGG + Intergenic
1187493186 X:19771979-19772001 AAAAATAACAAACACATATCAGG + Intronic
1187543106 X:20218611-20218633 AAATGTATAATACACATAACTGG + Intronic
1187717515 X:22117863-22117885 AAACTTATAAGAGAAATATCTGG + Intronic
1187966153 X:24614320-24614342 AAATTTGTAAAACACATTTTAGG + Intronic
1188229477 X:27643794-27643816 AAAAAAATCAAACACATATTAGG - Intronic
1188366569 X:29322954-29322976 AAAATATTTAAAAACATATCAGG - Intronic
1188837815 X:34979691-34979713 AAACTTGAAAAACACATTTCAGG + Intergenic
1188853296 X:35158868-35158890 AAAAAAATACAAAACATATCTGG + Intergenic
1188930515 X:36104410-36104432 AAAATTTTAAAAAACATGACAGG - Intronic
1189548362 X:42067507-42067529 AAAACTATAAAACATATATTAGG - Intergenic
1189976704 X:46467837-46467859 ATACTTGTAAAACACATAGCTGG - Intronic
1190113038 X:47607575-47607597 AACCTTAGAAAACACCTATCTGG + Intronic
1190123251 X:47680892-47680914 AAAATTGAAAAAGACATACCAGG - Intergenic
1190705485 X:53023501-53023523 AAAATAAAAAAACAAATATTAGG - Intergenic
1191062292 X:56311763-56311785 AAAACTATAAAAGGCATTTCAGG + Intergenic
1191174969 X:57489472-57489494 AAAATTATAAAACATTTTTGGGG - Intergenic
1192110937 X:68363469-68363491 AAAATAAAAAAAAACATAGCTGG - Intronic
1192192134 X:68997437-68997459 ACACTCATAAAACACTTATCAGG - Intergenic
1192276284 X:69634472-69634494 AAAATAATAAAAAAATTATCCGG - Intronic
1192374560 X:70546476-70546498 ATACTTACAAATCACATATCTGG + Intronic
1193087696 X:77461745-77461767 AAAATTTTAAAACAATTAGCTGG + Intergenic
1193208589 X:78778726-78778748 AAAAGCATAAAACACATTTTGGG - Intergenic
1193383314 X:80842652-80842674 AAAATTAAAAAAAAAATAACTGG + Intergenic
1193474969 X:81952125-81952147 AAAGTTATGAAACACATGGCCGG - Intergenic
1193512434 X:82420123-82420145 AAAATTATTCAACAAAAATCTGG + Intergenic
1193662587 X:84274911-84274933 ACATTTATAAAAGACATAGCAGG - Intergenic
1193673714 X:84420465-84420487 AAAACAATAAAGCACATATATGG + Intronic
1193944741 X:87721645-87721667 AAAAATATAAAACAGTTATCAGG - Intergenic
1194118239 X:89929502-89929524 AAAATCATAAAATACTTATTCGG - Intergenic
1194157356 X:90407590-90407612 AATATTATAAAACATAAATGAGG - Intergenic
1194181924 X:90721132-90721154 ACATTTATAAAGCACATAGCAGG - Intergenic
1194242041 X:91462031-91462053 AAAATTTTAAAAGACACATATGG + Intergenic
1194337674 X:92667368-92667390 ATAATTATAAGACACATTTAGGG + Intergenic
1194518243 X:94885837-94885859 AAAAAAAAAAAACACATAACAGG - Intergenic
1194679886 X:96839954-96839976 AAAATTTTAAATTACATATGTGG - Intronic
1195097561 X:101519051-101519073 AAAATAATAAAATATATATTAGG + Intronic
1195151757 X:102078341-102078363 AAAATTTAAAAACAAATAGCTGG + Intergenic
1195159614 X:102157966-102157988 AAAATTAGAAAACACAGGTAAGG + Intergenic
1196340501 X:114589987-114590009 AAAATTATTTATCATATATCAGG + Intronic
1196440621 X:115716538-115716560 AAAAATATAAAACAATTAGCTGG + Intergenic
1196577114 X:117332075-117332097 AACATTATAAAACAAATACTGGG + Intergenic
1196579635 X:117363481-117363503 AAAATTAAAAAAAAAATACCTGG + Intergenic
1196756648 X:119163071-119163093 AAAATTAAAAAAAAAATAGCTGG + Intergenic
1196926683 X:120640596-120640618 AAAATTAAAAAAAAAACATCTGG - Intergenic
1197010100 X:121550452-121550474 AAAGTTATGAAAGACATATGTGG + Intergenic
1197038902 X:121910434-121910456 AAAATCATAAATCACATAAGAGG + Intergenic
1197613893 X:128670701-128670723 AAAATTACAAATCACTTCTCAGG - Intergenic
1197843091 X:130771269-130771291 AAAATAATAAAACAAAGATTTGG + Intronic
1197948803 X:131872137-131872159 AAAATTATAAACCAATTATTAGG + Intergenic
1199064873 X:143404225-143404247 AGAATTAAAAAACATATATATGG - Intergenic
1200427843 Y:3041035-3041057 AAATTTAGAAAACAAATAACTGG - Intergenic
1200471117 Y:3587067-3587089 AAAATCATAAAATACTTATTCGG - Intergenic
1200503688 Y:3984582-3984604 AATATTATAAAACATAAATGAGG - Intergenic
1200528551 Y:4303049-4303071 ACATTTATAAAGCACATAGCAGG - Intergenic
1200646089 Y:5784110-5784132 ATAATTATAAGACACATTTAGGG + Intergenic
1201160686 Y:11163304-11163326 AAAATAAAAAAACACAAAACTGG - Intergenic
1201292725 Y:12437546-12437568 AAAATTGTTAAAATCATATCTGG + Intergenic
1201327089 Y:12773427-12773449 TAATTTGTTAAACACATATCTGG - Intronic
1201332100 Y:12835651-12835673 AAAAATACAAAAAACTTATCTGG + Intronic
1201352403 Y:13058341-13058363 AAAATAATAAGACTCATATATGG - Intergenic
1201499152 Y:14622832-14622854 AAAATTATAAAACATTAATTAGG - Intronic
1201504139 Y:14679141-14679163 AAAATAAAAAAATATATATCTGG - Intronic
1201563357 Y:15341787-15341809 CAACTTAGAAAACACATTTCAGG - Intergenic
1201585271 Y:15553227-15553249 AAAATTCTAAAATCAATATCTGG + Intergenic
1201734528 Y:17244021-17244043 AAAATTAGAAAACACTCTTCAGG - Intergenic
1201912235 Y:19144541-19144563 AAAAATATAAAAAATATACCAGG + Intergenic
1202070195 Y:20984254-20984276 AAAGTTAGAAAACACACTTCAGG - Intergenic