ID: 1060657067

View in Genome Browser
Species Human (GRCh38)
Location 9:125379320-125379342
Sequence GTCAATAACACCACGGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060657067_1060657073 20 Left 1060657067 9:125379320-125379342 CCCGTCCCCGTGGTGTTATTGAC No data
Right 1060657073 9:125379363-125379385 ATCCTGCATTTTTCATCCTTTGG No data
1060657067_1060657075 27 Left 1060657067 9:125379320-125379342 CCCGTCCCCGTGGTGTTATTGAC No data
Right 1060657075 9:125379370-125379392 ATTTTTCATCCTTTGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060657067 Original CRISPR GTCAATAACACCACGGGGAC GGG (reversed) Intergenic
No off target data available for this crispr