ID: 1060657068

View in Genome Browser
Species Human (GRCh38)
Location 9:125379321-125379343
Sequence GGTCAATAACACCACGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060657068_1060657073 19 Left 1060657068 9:125379321-125379343 CCGTCCCCGTGGTGTTATTGACC No data
Right 1060657073 9:125379363-125379385 ATCCTGCATTTTTCATCCTTTGG No data
1060657068_1060657075 26 Left 1060657068 9:125379321-125379343 CCGTCCCCGTGGTGTTATTGACC No data
Right 1060657075 9:125379370-125379392 ATTTTTCATCCTTTGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060657068 Original CRISPR GGTCAATAACACCACGGGGA CGG (reversed) Intergenic
No off target data available for this crispr